L4: Translation Process Flashcards
What are the 3 sections which make up the structure of mRNA?
- Promoter = transcriptional start site
- Coding region = transcript
- Terminator = Non-transcribed section of the region but ensure fidelity and protection of the transcribed coding region
What is the coding region made up of?
Exons and introns
What elements are found towards the 5’ end region of the promoter?
Upstream enhancers
Define upstream enhancers
A short (50-150 bp) region of DNA that can be bound to proteins, important activators to the transcription of a particular gene
Where are upstream enhancers located in terms of the coding gene?
- Sequences of DNA that can be several thousand kilo bases away from the promoter it is enhancing
- Far away in terms of base pairs that may intervene and enhance the promoter
How does the DNA double helix benefit the upstream enhancers?
Structure allows the enhancers to be bought closer (compact structure) to the promoters
Define promoter
- A regulatory region of DNA located upstream (towards the 5’ end) of a gene, providing a control point for regulated gene transcription
- Control and regulate gene expression
What is a TATA box?
- In the promoter region, these are a sequence of DNA that spell out TATA
- These can be a sequence like TATA or TAATA, or a string of letters that run together to make a TATA box
Define TATA box
A sequence of DNA, consisting of nucleobases TATAAA, located in the promoter region about 25-30 base pairs before the transcription start site
Can a gene be without a TATA box?
Yes
Some genes don’t have a TATA box, but have a specific motif that will allow the transcriptional machinery to identify that the region is important and needs to be transcribed
What is located before the first exon on the coding gene?
Towards the 5’ end is a sequence known as the untranscribed region (UTR)
What is an untranscribed region (UTR)?
Part of the DNA and gene, but not transcribed. Acts as a protector for the genome
What is located after the last exon in the coding gene?
- At the 3’ end is another untranscribed region (UTR)
- This acts as an insulator to protect the genome
What proteins does RNA polymerase require to aid in the process of transcription?
- TATA box = 25-30bp away from the transcription start site (TSS). TATAA n GCCC
- CCAAT box = 100 bp away from the TSS. TAGCCAATG
- GC box = 200 bp away from the TSS. ATAGGCGnGA
What structures make up mRNA?
From the 5’ to 3’ end
Leader, Reading frame, Trailer
What are UTRs in mRNA? Where are they found?
Untranslated regions
The UTRs are transcribed but not translated
Found in the leader and trailer regions of the mRNA sequence
Why does mRNA always vary in length?
Sequences of mRNA vary because amino acid coding sequences (reading frames) vary, and it depends on which reading frame is open and because leader and trailer sequences differ
Using the real example below, identify the reading frame, and the leader and trailer sequences of the sequence of mRNA:
5’ UACCAUGGCACUGGUCGAUCAUAAAGGGGGUCGAUGACC 3’
- No 3rd reading frame as there is no AUG start codon - no N-Met
- 2nd reading frame selected as there is a start and stop codon (AUG and UGA)
- Leader sequence at the 5’ end is U ACC (before TSS)
- Trailer sequence at the 3’ end is CC (after the transcript)
- All keeps an integral gene which can function
Describe the structure of a ribosome, with relation to subunits and relative size
- 2 subunits each of which contain rRNA and ribosomal proteins
- Large subunit which is 60 S (Svedbergs)
- Small subunit which is 40 S
- Overall forms an 80 S ribosome
What is a Svedberg?
A sediment coefficient through a gradient
What are the main components of the large subunit of a ribosome?
28 S rRNA
5.8 S rRNA
5 S rNA
50 ribosomal proteins
What are the main components of the small subunit of a ribosome?
18 S rRNA
30 ribosomal proteins
What is the main function of a ribosome?
- In translation the mRNA passes through ribosomes, the transcript is read, as the codons are recognised by tRNAs carrying specific amino acids
- Ribosomes are the site of translation
What main sites make up the large subunit of a ribosome?
- 3 main sites in total. 2 main one
- Peptidyl (P site) - tRNA binding site
- Aminoacetyl ( A site) - tRNA binding site
What role does tRNA play in translation?
- Correct amino acid selected by reading mRNA transcript
- Come into the ribosome and dock in the ribosome
- Hold the required amino acid in situ
What encodes the formation of tRNA?
tRNA genes
Describe the structure of tRNA
- All similar in size and shape
- All have bases CCA at the 3’ end where the amino acids attach at the acceptor stem
- Complementary base pairing along stems to add stability
- Anticodon which is complementary to the codon on the mRNA transcript
What enzyme is responsible for the addition of the amino acid to the acceptor stem on tRNA, based on the anticodon?
Aminoacyl-tRNA synthetase
What is the process called, by which the enzyme adds the amino acid to tRNA?
Aminoacylation or ‘charging’
How many aminoacyl-tRNA synthetases are there for the 20 amino acids?
20 of the enzyme for each of the 20 amino acids
Why are the enzymes able to select different amino acids?
- Enzymes able to identify and recognise the anticodon may be different on the tRNA
- All tRNAs with the same amino acid are ‘charged’ by the same enzyme, even though tRNA sequences including anticodons can differ
How are the tRNAs recognised by the enzymes?
- Recognised by enzyme specific contact points -
these are a small number of bases normally 1-5 - The bases can be from the 3’ end or the anticodon
- Usually at least one base from the anticodon is recognised and often one of the last 3 base pairs in the acceptor stem
What is the extreme case of tRNA recognition by which none of the anticodon is used in recognition?
Alanine is an extreme case which is identified by a single unique complementary base pair in the acceptor stem
Describe the process of ‘charging’ or aminoacylation
Use amino acid arginine in the example
1) Arginine and enzyme both present. The arginine docks into the enzyme using ATP in the process (energy driven process)
2) ATP loses 2 phosphate groups (pyrophosphate) to form AMP.
3) The AMP will form a covalent bond with the amino acid. The enzyme will undergo a conformational shape change to prevent another amino acid from docking
4) The tRNA molecule will bind to another part of the same enzyme and has the anticodon complementary to the mRNA transcript and arginine. AMP will be released
5) The tRNA and arginine will form a covalent bond between the carboxyl of the arginine and the hydroxyl of the ribose on tRNA. The enzyme undergoes conformational shape change
6) The ‘charged’ arginine-tRNA complex will be released by the enzyme, and the enzyme will return to its original shape to repeat the process
What is the function of the GTP cap on the 5’ end of mRNA in translation?
Physical cell signalling structure which signals to the ribosome
What is the function of the Poly (A) tail on the 3’ end of mRNA in translation?
Ensures stability and non-degradation of the mRNA until at the ribosome and the process of translation is complete
Describe the process of translation at the ribosome
1) The 40 S subunit comes in and finds the start codon for methionine (identifies the TSS). This is an energy driven process, requiring ATP. The 40 S subunit has the initiation components
2) ATP = ADP and Pi
3) ‘Charged’ methionine attached to the tRNA will come in and complement the codon on mRNA at the TSS
4) The 60 S subunit comes in and completes the initiation complex
5) The Met will fit into the P site of the 60 S subunit
6) The next 3 bases/codon on the transcript are read, and the anticodon with amino acid attached for the next 3 bases/codon, will come in at the A site of the 60 S.
7) The two amino acids bond forming a peptide bond. Elongation of the polypeptide chain commences.
8) The process repeats, with the amino acids moving along from the A site to the P site after the peptide bond is formed
9) Poly (A) tail released and deacylated tRNA released uncharged ready for repeat of the same process
Why does one amino acid remain in the P site whilst another comes into the A site?
Ensures the two amino acids are close together to form a peptide bond
Why does the amino acid in the A site move into the P site after translation?
Leaves the A site available and ready for another tRNA to come in with the next amino acid
What happens at the end of translation when a stop codon is met?
- Termination of the stop codon, brings in a release factor
- The polypeptide is released and synthesis ends. The two subunits of the ribosomes separate and and the mRNA is released and degrades.
- The whole complex dissociates at the end of translation
Define polysomes
Several ribosomes can translate a mRNA sequence at the same time, producing many polypeptides simultaneously from a single mRNA - efficient process
Why are polysomes useful?
mRNA is degraded quickly so to make the process efficient and produce the polypeptides quickly polysomes are used
How can the process of protein synthesis be made efficient to meet the demands of certain proteins?
- Produce lots of transcripts for the same proteins
- Use lots of polysomes in translation
- Results in lots of the desired protein
How does protein synthesis change for slow turnover proteins?
- Not required as much
- Gene is transcribed, then gene is turned off and there will be a transcript
- Transcript will be translated and the RNA degraded after the protein is made
Are some genes expressed more than others?
- Yes
- Some genes are very transcriptionally active as these are required more frequently
- Some genes are slow turnover or silenced until required
What is an example of highly expressed genes?
- ‘Fight of flight genes’ e.g. heat shock proteins required to prevent damage
- Already primed and polymerase is stalled for a rapid response
