GEN EXAM 3 QUIZZES Flashcards
A _______ frequently integrates into the host genome, forming prophages and utilizing a lysogenic cycle to manufacture new phages.
A. eukaryotic cell
B. virulent phage
C. temperate phage
D. bacteria
C. temperate phage
A _______ uses the lytic cycle to begin the immediate manufacture of new phages in the host cells.
A. eukaryotic cell
B. temperate phage
C. virulent phage
D. bacteria
C. virulent phage
What is true in both phage λ and HIV infections?
A. Cell lysis always occurs immediately after virus introduction.
B. There can be a long latent period where no sign of infection, such as cell death, is detectable.
C. Assembled viral particles are always found within the cell.
B. There can be a long latent period where no sign of infection, such as cell death, is detectable.
Which virus uses reverse transcriptase in its reproductive cycle?
A. HIV
B. Phage lambda
C. Both of the viruses use reverse transcriptase
D. Neither of the viruses use reverse transcriptase
A. HIV
Vaccines have been very useful in preventing viral diseases. In fact, they have lead to the eradication of smallpox from the world’s human population. Most vaccines result in the host producing antibodies (proteins that bind to specific amino acid sequences) that bind to specific viral proteins. What might be a reason why a vaccine for HIV has been so difficult to develop?
A. The low mutation rate of HIV
B. The fact that HIV genome is found as both DNA and RNA in a cell
C. The high mutation rate of HIV
D. The HIV virion is coated with cellular proteins
C. The high mutation rate of HIV
What is the genetic material in the T4 bacteriophage?
A. double-stranded RNA
B. single-stranded RNA
C. single-stranded DNA
D. double-stranded DNA
D. double-stranded DNA
Which is a property of emerging viruses?
A. May lead to a significant loss of human life
B. Recent origin
C. More likely to cause infection compared to other strains
D. All of these
D. All of these
If protein was the genetic material of TMV rather than RNA, what would be the result of the Fraenkel-Conrat/Singer experiments when using HR proteins and wild-type RNA?
A. HR type lesions, no histidine and methionine in the capsid protein
B. Wild type lesions, histidine and methionine in the capsid protein
C. Wild type lesions, no histidine and methionine in the capsid protein
D. HR type lesions, histidine and methionine in the capsid protein
D. HR type lesions, histidine and methionine in the capsid protein
You perform an experiment like that performed by Fraenkel-Conrat and Singer on TMV. However, in the first step when the viruses are reconstituted, you decide to add RNase to your HR RNA and wild-type proteins. What will be the content of the newly made viral proteins after the reconstituted virus is placed on leaves?
A. No new viral proteins will be made.
B. The proteins will contain histidine and methionine.
C. The proteins will not contain histidine and methionine.
D. The proteins will contain histidine and methionine, but not as much as HR proteins do.
A. No new viral proteins will be made.
What is the genetic material in the parvovirus?
A. single-stranded RNA
B. double-stranded RNA
C. double-stranded DNA
D. single-stranded DNA
D. single-stranded DNA
The HIV drug fostemsavir binds to glycoprotein gp120, which is a viral envelope protein. Based on what you know about the lifecycle of HIV, with what step do you predict fostemsavir interferes?
A. synthesis of viral components
B. attachment
C. viral assembly
D. entry
E. integration
F. release
B. attachment
A bacteriophage that is physically integrated into the host chromosome is called a ________.
A. prophage
B. heteroduplex
C. envelope phage
D. plaque
A. prophage
What was the outcome of the experiment that reconstituted two different strains of tobacco mosaic viruses that had different infection characteristics?
A. the difference in infection characteristics depended only on the RNA sequence of the virus strain
B. the differences in infection characteristics depended only on the protein coat
C. the differences in infection characteristics depended on an RNA and protein coat interaction
A. the difference in infection characteristics depended only on the RNA sequence of the virus strain
Imagine Rosalind Franklin had performed X-ray diffraction on double-stranded RNA as well as double-stranded DNA. What would be a key difference that she would have observed between these two molecules?
A. DNA double helices are parallel whereas RNA double helices are antiparallel.
B. A DNA helix contains about 10 bp per turn, whereas an RNA helix contains 11 to 12 bp per turn.
C. RNA forms a left-handed helix while DNA forms a right-handed helix.
D. DNA but not RNA forms a helical structure.
B. A DNA helix contains about 10 bp per turn, whereas an RNA helix contains 11 to 12 bp per turn.
The individual(s) who used ball-and-stick models to identify the three-dimensional structure of proteins was _______.
A. Hershey and Chase
B. Chargaff
C. Watson and Crick
D. Franklin
E. Pauling
E. Pauling
Avery, Macleod, and McCarty used the enzyme _______ to remove the proteins from the cell extracts.
A. protease
B. DNase
C. RNase
A. protease
Frederick Griffith is responsible for discovering what process?
A. transformation
B. transmission
C.replication
D. transduction
A. transformation
The purine bases are _______.
A. adenine and guanine
B. cytosine, thymine, and uracil
C. adenine and thymine
D. cytosine and guanine
A. adenine and guanine
The building blocks of DNA are called _________.
A. alleles
B. nucleotides
C. amino acids
D. codons
B. nucleotides
Which RNA structural pattern does NOT contain single-stranded regions?
A. Bulge loop
B. Internal loop
C. Stem-loop
D. Multibranched junction
D. Multibranched junction
The backbone of the DNA molecule is formed by ________.
A. peptide bonds
B. ribose sugars
C. phosphodiester bonds
D. nitrogenous bases
C. phosphodiester bonds
Adenine and thymine form _______ hydrogen bonds between them, while cytosine and guanine form _______ bonds.
A. 4; 3
B. 3; 4
C. 3; 2
D. 2; 3
D. 2; 3
What form of DNA is most common in living organisms?
A. R DNA
B. A DNA
C. Z DNA
D. B DNA
D. B DNA
How many origins of replication are there in a bacterial chromosome?
A. More than two
B. 2
C. 0
D. 1
D. 1
Which of the following is found at the end of a eukaryotic chromosome?
A. kinetochores
B. telomeres
C. centromeres
D. nucleoids
B. telomeres
What is one reason why an amphibian, such as a salamander, might have a larger genome than a mammal, such as a chimpanzee?
A. The amphibian is more complex than the mammal.
B. The amphibian has more repetitive sequences than the mammal.
C. The amphibian has more structural genes than the mammal.
D. The amphibian has more introns than the mammal.
B. The amphibian has more repetitive sequences than the mammal
Where is the bacterial chromosome located?
A. nucleoid
B. nucleolus
C. nucleus
D. nuclear envelope
A. nucleoid
Which statement is true concerning chromosome compaction during cell division?
A. Overall chromosomal length is shortened.
B. Loop domains are not anchored to the scaffolding proteins.
C. Compaction results in increased transcriptional rates.
D. The 30 nm fibers are altered to 60 nm fibers.
A. Overall chromosomal length is shortened.
How many types of histone proteins are there?
A. 7
B. 4
C. 8
D. 5
D. 5
About how many bases of DNA wrap around a histone complex?
A. 200
B. <50
C. >1,000
D. 146
D. 146
The experiment by Noll, 1974, supported the observation that histones were regularly spaced on chromosomes because
A. digestion with low or high amounts of DNase I resulted in a fragment that was found at the bottom of the gel.
B. limited digestion with DNase I resulted in DNA fragments that differed in size by approximately 200 bp.
C. digestion with increased amounts of DNase I resulted in one or a few bands.
D. a digestion performed with a moderate amount of DNase I gave results that were ver
B. limited digestion with DNase I resulted in DNA fragments that differed in size by approximately 200 bp.
A transposon is inserted into the sequence 5’ GACTC 3’. Following simple transposition into this site, what sequences flank the transposon?
A. 5’ GACTC 3’; 5’ GACTC 3’
B. 5’ CTCAG 3’; 5’ CTCAG 3’
C. 5’ CTCAG 3’; 5’ GACTC 3’
D. 5’ GACTC 3’; 5’ CTCAG 3’
A. 5’ GACTC 3’; 5’ GACTC 3’
Which of the following enzymes is required for simple transposition?
A. Integrase
B. Jumpase
C. Transposase
D. Splicase
C. Transposase
According to Chargaff’s rule, if the DNA of a species contains 20% adenine, what percent of guanine will it contain?
A. 50%
B. 75%
C. 20%
D. 30%
D. 30%
The individuals who determined that Griffith’s transforming principle was DNA were __________.
A. Watson and Crick
B. Hershey and Chase
C. Creighton and McClintock
D. Avery, Macleod, and McCarty
D. Avery, Macleod, and McCarty
Choose the RNA molecule that would be complementary to this DNA molecule: 5’-TTAACCGG-3’.
A. 5’-UUAACCGG-3’
B. 5’-AAUUGGCC-3’
C. 3’-AATTGGCC-5’
D. 3’-AAUUGGCC-5’
D. 3’-AAUUGGCC-5’
The fact that the two DNA strands are arranged in opposite orientations gives DNA its _____ characteristics.
A. antiparallel
B. water-soluble
C. redundant
D. complementary
A. antiparallel
How many bases are necessary to complete one complete twist (360 degrees) of a DNA double helix?
A. 100
B. 5
C. 10
D. 1000
C. 10
Human chromosome 3 is almost 200 million base pairs in length. How many origins of replication do you predict will be found on human chromosome 3?
A. 200,000
B. 1
C. 20,000
D. 2,000
E. 2
D. 2,000
Topoisomerase I does which of the following?
A. relax negative supercoils
B. introduce negative supercoils
C. More than one of these choices are correct.
D. relieve positive supercoils
A. relax negative supercoils
The correct order of compaction from least compacted to most compacted would be
A. naked DNA, nucleosome, 30 nm fiber, loop, metaphase chromosome.
B. naked DNA, loop, 30 nm fiber, nucleosome, metaphase chromosome.
C. naked DNA, 30 nm fiber, nucleosome, loop, metaphase chromosome.
D. naked DNA, metaphase chromosome, loop, 30 nm fiber, nucleosome.
A. naked DNA, nucleosome, 30 nm fiber, loop, metaphase chromosome.
A double stranded stretch of eukaryotic DNA is 4,000 bp long. If the average linker is about 54 base pairs, how many molecules of histone H3 would be present on this piece of DNA?
A. 40
B. 74
C. 20
D. 148
A. 40
Areas of the chromosome that are highly condensed and transcriptionally inactive are called
A. superchromatin.
B. euchromatin.
C. exons.
D. heterochromatin.
D. heterochromatin.
The zigzag model is associated with the _______ level of DNA organization.
A. 30 nm fiber
B. scaffold protein
C. histone
D. 11nm fiber
E. beads-on-a-string
A. 30 nm fiber
Which of the following is technically NOT part of the genetic information of a transposable element?
A. inverted repeats
B. direct repeats
C. insertion elements
D. transposase
B. direct repeats
Consider a simple transposition event in a region of the genome where DNA replication is not actively occurring. At the end of the event how many copies of this transposon will be present in the genome?
A. 4
B. 2
C. There is not enough information given to determine how many transposons will be present.
D. 1
D. 1
The researcher(s) who initially used X-ray diffraction to gather information on the DNA molecule was ______.
A. Hershey and Chase
B. Franklin
C. Pauling
D. Chargaff
E. Watson and Crick
B. Franklin
The _______ was/were labeled using the radioisotope 32P in the Hershey-Chase experiments.
A. carbohydrates
B. RNA
C. DNA
D. proteins
C. DNA
These individuals determined that DNA was the genetic material in T2 phage.
A. Creighton and McClintock
B. Avery, Macleod, and McCarty
C. Watson and Crick
D. Hershey and Chase
D. Hershey and Chase
How is the directionality of a DNA molecule described based on the orientation of sugar molecules within the strand?
A. left to right
B. top to bottom
C. A to T or G to C
D. All DNA molecules are different in their directionality.
E. 5′ to 3′
E. 5′ to 3′
How many total hydrogen bonds would be found holding together the base pairs in a double stranded DNA molecule containing the following nucleotides:
5’-TAGCCCTT-3’
3’-ATCGGGAA-5’
A. 16
B. 20
C. 8
D. 24
B. 20
Unique sequences make up approximately what percent of the human genome?
A. 40%
B. 80%
C. 25%
D. 5%
A. 40%
What is a nucleosome composed of?
A. Two turns of DNA wrapped around an octet core of histone proteins.
B. DNA wrapped twice around a histone octet and includes approximately 200 bases that are not associated with the histones.
C. It is composed of 2 copies each of H2A, H2B, H3, and H4 and 1 copy of H1.
D. Two copies each of H2A, H2B, H3, and H4.
A. Two turns of DNA wrapped around an octet core of histone proteins.
The formation of what structure would be impaired if a cell was lacking CTCF proteins?
A. Double helix
B. Nucleosome
C. Loop domains
D. 30-nm fiber
C. Loop domains
Long-terminal repeats are unique to which group of transposons?
A. integrase
B. non-LTR retrotransposons
C. simple transposons
D. LTR retrotransposons
D. LTR retrotransposons
During a retrotransposition event, 4 DNA copies of a retrotransposon are created. At the end of this event, how many total copies of the retrotransposon will be found in the genome?
A. 1
B. 5
C. 10
D. 8
E. 4
B. 5
The idea that the adenine and thymine bases of the DNA interact in some manner was first proposed by _______.
A. Franklin
B. Chargaff
C. Pauling
D. Watson and Crick
B. Chargaff
The term nucleic acids is used to describe RNA and DNA because
A. they are acidic molecules and have no charge at neutral pH.
B. they are acidic molecules and have a net positive charge at neutral pH.
C. they are acidic molecules and have a net negative charge at neutral pH.
C. they are acidic molecules and have a net negative charge at neutral pH.
One strand of DNA is 5′ - AGGCCTTA - 3′. What is the opposite strand?
A. 3′ - AGGCCTTA - 5′
B. 5′ - AGGCCTTA - 3′
C. 5′ - TCCGGAAT - 3′
D. 3′ - TCCGGAAT - 5′
D. 3′ - TCCGGAAT - 5′
The DNA of a bacterial cell must be compacted about _______ fold to fit within the confines of the cell.
A. 150
B. 1,000,000
C. 100
D. 1000
E. 10
D. 1000
A chromosome territory is defined as
A. a region in the nucleus that may have several chromosomes.
B. a region on a chromosome that is devoid of nucleosomes.
C. a region in the nucleus that is occupied by a single chromosome.
D. a region on a chromosome that has no protein encoding genes.
C. a region in the nucleus that is occupied by a single chromosome.
The individual who first proposed the existence of transposable elements was ____.
A. Morgan
B. Sturtevant
C. Franklin
D. McClintock
E. Watson
D. McClintock
The fact that the type R and S strains of Streptococcus pneumoniae that Griffith worked with possessed small differences in capsule structure satisfies which of the following criteria for genetic material?
A. replicatio
B. information
C. variation
D. transmission
C. variation
What is a mechanism of condensation shared by both prokaryotes and eukaryotes?
A. nucleosomes
B. loop domains
C. 30 nm fiber
D. None of these choices are correct.
B. loop domains
Where do kinetochores attach to chromosomes?
A. centromeres
B. telomeres
C. specific genes on the chromosome
D. they do not attach to DNA
A. centromeres
What is the first level of chromosome compaction among the following choices?
A. closer association of loop domains
B. 30 nm fibers
C. loop domains
D. nucleosomes
D. nucleosomes
Following transcription, the RNA has a complementary sequence to
A. the coding strand of DNA
B. termination sequences
C. the template strand of DNA
D. regulatory sequences
C. the template strand of DNA
What is the name of the site in eukaryotic DNA where general transcription factors associate?
A. terminator
B. silencer
C. enhancer
D. promoter
D. promoter
What enables the splicing of group I and II introns?
A. snRNA
B. ribozymes
C. poly-A tail
D. spliceosomes
B. ribozymes
You are working in a lab studying mRNAs from many different species. You need to distinguish between mRNAs in a mixed sample. You begin by having all of the mRNAs sequenced, including the mitochondrial mRNAs. You notice a high number of C to U conversions in the mitochondrial mRNAs from a certain portion of the sample. You conclude that this portion of the sample is from __________.
A. slime mold
B. Trypanosomes
C. Drosophila
D. Mammals
E. Plants
E. Plants
Most eukaryotic genes are colinear
A. True
B. False
C. It is unknown at this time
B. False
In prokaryotes, a holoenzyme is formed when what is added to the core enzyme?
A. b
B. b’
C. Start codons
C. σ
E. a
C. σ
Which subunit of the prokaryotic RNA polymerase carries out catalytic synthesis of RNA?
A. alpha
B. beta
C. omega
D. sigma
B. beta
How many general transcription factors are needed for eukaryotic translation?
A. 6
B. 4
C. 3
D. 5
D. 5
A mutation occurs in one of the general transcription factors necessary for eukaryotic transcription. A pre-initiation complex forms, but the open complex does not form. Further, TFIIB, TFIIE, and TFIIH are not released from the DNA. The mutation is most likely in which general transcription factor?
A. TFIID
B. TFIIB
C. TFIIH
D. TFIIF
E. TFIIE
C. TFIIH
Azidothymidine (AZT) is an HIV drug. AZT is a reverse transcriptase inhibitor. That means AZT is only effective during the __________ stage of the viral life cycle.
A. entry
B. integration
C. viral assembly
D. release
B. integration
An Alu sequence is an example of what?
A. Retro element
B. Transposable element
C. Highly repetitive DNA
D. All are correct
C. Highly repetitive DNA
What is the highest level of chromosome condensation among the following choices?
A. nucleosome
B. Loop domain
C. 30 nm fibers
D. Double helix
B. Loop domain
What types of amino acids are most responsible for the binding of DNA to histones?
A. Hydrophobic amino acids
B. Polar amino acids
C. Positively charged amino acids
D. Negatively charged amino acids
C. Positively charged amino acids
Which enzyme is unique to the retro elements?
A. Reverse transcriptase
B. Reverse resolvase
C. Transposase
D. Integrase
E. Reverse integrase
A. Reverse transcriptase
Which of the following is an example of a processive enzyme?
A. DNA polymerase I
B. DNA polymerase III
C. DNA ligase
D. Okazaki fragments
B. DNA polymerase III
What functions are accomplished by the primosome?
A. Tracking along DNA
B. Tracking along DNA, separating double stranded DNA
C. Tracking along DNA, separating double stranded DNA, synthesizing RNA primers
D. Tracking along DNA, separating double stranded DNA, synthesizing RNA primers, adding nucleotides
C. Tracking along DNA, separating double stranded DNA, synthesizing RNA primers
Imagine you are able to watch DNA replication under a microscope in a mutant strain of bacteria. The parental strands appear to unwind and separate, but then they immediately join back together before any new DNA can be synthesized. What protein is missing or defective in this bacterial strain?
a. Ligase
b. Single-strand binding proteins
c. Primase
d. DNA polymerase
b. Single-strand binding proteins
Which enzyme manufactures a 10-12 base segment of RNA?
A. DNA polymerase
B. DNA primase
C. Topoisomerase
D. DNA ligase
E. DNA polymerase III
B. DNA primase
DNA helicase enzymes move in what direction along the DNA during DNA replication?
A. 5’ to 3’
B. 3’ to 5’
C. They remain stationary
A. 5’ to 3’
DNA polymerase III carries out leading and lagging strand synthesis in prokaryotes. How many enzymes accomplish this task in eukaryotes (not counting primer creation)?
A. three
B. one
C. four
D. two
D. two
In E. coli, which protein(s) are necessary for the cell to recognize double-stranded breaks and conduct recombination during meiosis?
A. RecG
B. RecA
C. RecBCD
D. RuvABC
C. RecBCD
You have isolated what appears to be alien DNA. While studying its replication, you performed the exact experiment Meselson and Stahl did. After three generations, the DNA is subjected to a CsCl gradient and only one band appears. What type of replication does this DNA undergo?
A. Semiconservative
B. Conservative
C. Dispersive
C. Dispersive
Which of the following best describes the mechanism of DNA replication in which both parental strands remain together following replication?
A. Dispersive
B. Semi-conservative
C. Conservative
D. All of the answers are correct
C. Conservative
The consensus sequences in a prokaryotic promoter are 5’TTGACA3’ and 5’TATAAT3’ at -35 and -10, respectively. What sequence would be most easily recognized by σ factor?
A. 5’TATATA3’
B. 5’TTGAAA3’
C. 5’TTCAGA3’
D. 5’TAAATT3’
B. 5’TTGAAA3’
In eukaryotic organisms, the processing of the 45S rRNA into 5.8S, 18S and 28S rRNA occurs where?
A. In the cytoplasm
B. In the nucleolus
C. In the endoplasmic reticulum
D. In the Golgi body
E. Throughout the cell
B. In the nucleolus
In eukaryotic organisms, what RNA modification is important for mRNA stability?
A. base modification
B. 3’ polyA tailing
C. RNA editing
D. processing
B. 3’ polyA tailing
What structural motif is most commonly used by transcription factors in binding to DNA?
A. Zinc-finger
B. Helix-turn-helix
C. Leucine zipper
D. Homeodomain
B. Helix-turn-helix
In eukaryotic organisms, what protein allows RNA polymerase II to interact with transcription factors bound to enhancers or silencers?
A. Mediator
B. TFIIB
C. TFIID
D. Sigma factors
A. Mediator
What basal transcription factor is a helicase?
A. TFIID
B. TFIIH
C. TFIIF
D. TFIIB
B. TFIIH
In eukaryotic organisms, a mutation in which of the following would result in a failure of the RNA polymerase to maintain an open complex?
A. TFIIB
B. TFIIF
C. TFIIE
D. TFIID
E. TFIIH
C. TFIIE
In the attachment of a nucleotide to a DNA strand, the cleavage of the dNTP into deoxyribonucleoside monophosphate and pyrophosphate is ______.
A. endergonic
B. exergonic
C. energy neutral
B. exergonic
What enzyme relaxes supercoiling ahead of the replication fork?
A. DNA polymerase I
B. DNA primase
C. DNA polymerase III
D. topoisomerase
D. topoisomerase
Which enzyme fills in small regions of DNA where the RNA primers were located?
A. DNA polymerase III
B. DNA ligase
C. topoisomerase
D. DNA polymerase I
E. DNA primase
D. DNA polymerase I
Which enzyme synthesizes the lagging strand of the DNA?
A. DNA polymerase I
B. DNA polymerase III
C. Topoisomerase
D. DNA primase
B. DNA polymerase III
In yeast, which of the following is similar to the oriC region of prokaryotes?
A. ARS elements
B. promoters
C. centromeres
D. telomeres
A. ARS elements
Which recombination model involves formation of a D-loop?
A. double-stranded break model
B. Holliday model
C. single-stranded break model
A. double-stranded break model
Which describes the mechanism of DNA replication in which the newly made double-stranded DNA contains one parental strand and one daughter strand?
A. semiconservative
B. conservative
C. dispersive
A. semiconservative
The first generation of replication in the Meselson and Stahl experiment disproved which theory of replication?
A. None—it took more than one generation to disprove the theory.
B. semiconservative
C. dispersive
D. conservative
D. conservative
Select the feature that is incorrect about this DNA double strand:
5’-ATGCCCGGAAC-3’
5’-TACGGGCCTTG-3’
A. The nucleotides are not base paired correctly.
B. The strands are not anti-parallel.
C. Chargaff’s rules are not observed.
D. U should be used instead of T.
B. The strands are not anti-parallel.
Quinolones kill bacteria by what mechanism?
A. They inhibit DNA gyrase.
B. They inhibit DNA compaction.
C. They inhibit DNA replication.
D. All of these choices are correct.
A. They inhibit DNA gyrase
You are in the lab trying to synthesize DNA in vitro. You are upset because the lab seems to be out of dNTPs (deoxynucleoside triphosphates) but you find a tube of dNMPs (deoxynucleoside monophosphates) in the freezer. You add this to your replication reaction instead of dNTPs. Will your reaction work? Why or why not?
A. Yes, the formation of the covalent bond between the nucleoside monophosphate and the growing DNA strand is energetically favorable.
B. Yes, only the nucleoside monophosphate ult
C. No, cleavage of dNTP drives the formation of the covalent bond between the nucleoside monophosphate and the growing DNA strand.
D. No, all three phosphates on the nucleoside triphosphate are incorporated into the growing DNA strand
C. No, cleavage of dNTP drives the formation of the covalent bond between the nucleoside monophosphate and the growing DNA strand.
How many DNA polymerases are found in prokaryotes?
A. 12
B. 7
C. 5
D. 9
C. 5
Which enzyme attaches adjacent Okazaki fragments, forming a continuous DNA strand?
A. topoisomerase
B. DNA primase
C. DNA polymerase III
D. DNA ligase
E. DNA polymerase I
D. DNA ligase
DNA polymerases are unable to replicate what areas of the chromosome?
A. 3′ ends
B. centromeres
C. 5′ ends
D. origins of replication
A. 3′ ends
What process does the Holliday model help explain?
A. recombination between sister chromatids
B. recombination between homologous chromosomes
C. replication initiation
D. the creation of shortened chromosomes
B. recombination between homologous chromosomes
The purpose of DNA replication is to produce ______.
A. two template strands
B. two daughter strands
C. two parental strands
D. four daughter strands
B. two daughter strands
In eukaryotic organisms, what process is important for the initiation of translation?
A. alternative splicing
B. 5’ capping
C. RNA editing
D. base modification
B. 5’ capping
Both the rho-dependent and rho-independent mechanisms of termination
A. involve the formation of a stem-loop structure.
B. end transcription immediately after the stop codon.
C. involve a sequence rich with A-U base pairs.
D. require a helicase to separate the DNA-RNA complex.
A. involve the formation of a stem-loop structure.
In trying to distinguish between the two models of eukaryotic transcriptional termination, you identify a drug that specifically blocks exonuclease activity. When you add it at the appropriate time to an in vitro system that carries out all the stages of eukaryotic transcription, you find that transcription proceeds normally, but transcription doesn’t terminate. This experiment provides support for which model of eukaryotic transcriptional termination?
A. Rho-dependent termination
B. Rho-independent termination
C. Allosteric model
D. Torpedo model
D. Torpedo model
DNA polymerases add new nucleotides in what direction?
A. both directions
B. 3′ to 5′
C. 5′ to 3′
C. 5′ to 3′
What is the purpose of phosphorylating the carboxy terminal domain (CTD) of RNA Polymerase II?
A. allow transcription factors to bind the TATA box
B. phosphorylate transcription factors
C. convert from the initiation to the elongation stage
D. to aid in transcriptional initiation
C. convert from the initiation to the elongation stage
Suppose you performed a triplet binding assay with the triplet 5′-UAA-3′. Among those listed below, what radiolabeled amino acids do you expect to find bound to the filter?
A. Tyrosine
B. Glycine
C. Methionine
D. None
D. None
Where are the ribosomal subunits assembled?
A. nucleolus
B. nucleoid
C. nuclear envelope
D. nucleus
A. nucleolus
Which component of the ribosome is part of the peptidyl transferase in the 50S subunit and acts as a ribozyme to catalyze peptide bond formation?
A. aminoacyl-tRNA synthetase
B. Shine-Dalgarno sequence
C. P site
D. 23S rRNA
E. 16S rRNA
F. snRNA
D. 23S rRNA
Which component of the ribosome is able to detect when the wrong tRNA has inserted into the A site?
A. 16S rRNA
B. P site
C. snRNA
D. Shine-Dalgarno sequence
E. 23S rRNA
F. aminoacyl-tRNA synthetase
A. 16S rRNA
The peptidyltransferase complex is a component of which of the following?
A. DNA
B. tRNA
C. The ribosome
D. mRNA
E. The growing polypeptide
C. The ribosome
A tRNA’s anticodon is 5′GGC3′. What amino acid is attached to it?
A. glycine
B. alanine
C. proline
D. arginine
B. alanine
A tRNA that has an amino acid attached is called _____.
A. rRNA
B. degenerate tRNA
C. coding tRNA
D. charged tRNA
E. None of the answers are correct.
D. charged tRNA
You are studying the DNA of a person who you know has two defective copies of the gene that encodes phenylalanine hydroxylase. You are surprised to find that this person also carries two defective copies of the gene for homogentisic acid oxidase. What disease symptoms will this person exhibit? (Assume pathway intermediates are not available from sources outside the phenylalanine breakdown pathway.)
A. This person will exhibit symptoms of tyrosinosis.
B. This person will be phenotypically normal.
C. This person will exhibit symptoms of alkaptonuria and phenylketonuria.
D. This person will exhibit symptoms of alkaptonuria.
E. This person will exhibit symptoms of phenylketonuria.
E. This person will exhibit symptoms of phenylketonuria.
The primary structure of a protein refers to
A. the linear sequence of the amino acids.
B. regular repeating shapes, such as beta-sheets.
C. the interaction of two or more peptide chains.
D. the three-dimensional shape of the protein.
A. the linear sequence of the amino acids.
In eukaryotic organisms, alternative splicing allows an organism to ___________.
A. produce only one protein from a gene.
B. produce nonfunctional variants of proteins from a gene
C. produce several different proteins from a single gene.
C. produce several different proteins from a single gene.
Which enzyme is responsible for the majority of DNA synthesis during replication?
A. DNA polymerase I
B. DNA polymerase III
C. DNA primase
D. DNA ligase
E. topoisomerase
B. DNA polymerase III
You have an RNA molecule that contains introns. You wish to carry out an in vitro splicing reaction with this RNA and cellular extracts. You want to determine if splicing is occuring via self-splicing or through the spliceosome. What enzyme could you add to the reaction to make this determination?
A. RNase
B. Protease
C. DNase
D. Lipase
B. Protease
Which of the following best describes the function of the RecA protein in E. coli?
A. Recognizes double-stranded breaks in the DNA
B. Involved in the initial formation of Holliday junctions
C. Resolves Holliday junctions into separate chromosomes
D. Promotes strand invasion and D-loop formation in the double-stranded break model
D. Promotes strand invasion and D-loop formation in the double-stranded break model
Which of the following forms of RNA encodes the sequence of amino acids for a functional protein?
A. rRNA
B. tRNA
C. snRNA
D. mRNA
E. scRNA
D. mRNA
Which answer would best represent the composition of double stranded DNA?
A.
15% A
25% G
15% C
35% T
B.
20% A
20% G
20% C
40% T
C.
30% A
15% G
15% C
30% T
D.
20% A
20% G
30% C
30% T
C.
30% A
15% G
15% C
30% T
If eukaryotic cells evolved such that lagging strand DNA synthesis could occur continuously (without the use of Okazaki fragments), what enzyme would likely no longer be needed for DNA replication?
A. Flap endonuclease
B. Helicase
C. Topoisomerase
D. Primase
A. Flap endonuclease
The scientist(s) __________ studied patients who had defects in their ability to metabolize certain compounds, particularly the inherited disease alkaptonuria. He/They proposed that a relationship exists between the inheritance of the trait and the inheritance of a defective enzyme.
A. Beadle and Tatum
B. Garrod
C. Khorana and colleagues
D. Nirenberg and Leder
E. Nirenberg and Matthaei
B. Garrod
The scientist(s) __________ developed the triplet-binding assay. Samples containing ribosomes and a particular RNA triplet were exposed to charged tRNAs with different radiolabeled amino acids. Only the amino acid whose tRNA matched the triplet would bind the ribosome. The triplet-binding assay established relationships between particular triplet sequences and specific amino acids.
A. Beadle and Tatum
B. Garrod
C. Khorana and colleagues
D. Nirenberg and Leder
E. Nirenberg and Matthaei
D. Nirenberg and Leder
In bacteria, the sequence that facilitates the binding of the mRNA to the ribosome is called the
A. Kozak sequence.
B. rRNA sequence.
C. Shine-Dalgarno sequence.
D. start sequence.
C. Shine-Dalgarno sequence.
What site on the ribosome is primarily responsible for holding the growing polypeptide?
A. E
B. A
C. P
C. P
Which molecule contains an anticodon?
A. mRNA
B. rRNA
C. snRNA
D. DNA
E. tRNA
E. tRNA
What is the least number of tRNAs that can be used to recognize all of the codons of isoleucine, and what is/are the anticodon(s)? (In the answer choices, I = inosine.)
A. one—5′UAU3′
B. two—5′GAU3′ and 5′UAU3′
C. one—5′IAU3′
D. two—5′AUA3′ and 5′UAI3′
C. one—5′IAU3′
What level of protein structure is exemplified by α-helices and β-sheets?
A. tertiary structure
B. quaternary structure
C. secondary structure
D. primary structure
C. secondary structure
What is the purpose of Okazaki fragments?
A. to reform the double helix following replication
B. to allow DNA to be synthesized in the 5’ to 3’ direction on the leading strand
C. to assist in the formation of the replication fork
D. to allow DNA to be synthesized in the 5’ to 3’ direction on the lagging strand
D. to allow DNA to be synthesized in the 5’ to 3’ direction on the lagging strand
In prokaryotic organisms, what structural motif is used by sigma factor to bind to DNA?
A. helix-turn-helix
B. leucine zipper
C. homeodomain
D. zinc-finger
A. helix-turn-helix
What region in eukaryotic genes contains the majority of regulatory elements?
A. 0 to 50
B. -50 to -100
C. -50 to 0
D. -100 to -150
B. -50 to -100
Select the nitrogenous base found only in RNA.
A. cytosine
B. adenine
C. thymidine
D. uracil
D. uracil
You are studying a protein in the frog Xenopus laevis. This organism has a high percentage of transposable elements (TEs) in its genome. After several months of experiments, you start experiencing strange results. It appears that your protein is no longer being made! You look at the chromosomes from the cells where the protein is not being produced, and they all appear normal. You also sequence the coding region of your gene and it has a normal sequence. What is the most likely explanation for your missing protein?
A. A mutation has occurred due to incorrect excision of a TE from your gene
B. Exon shuffling has occurred, and there was no exon in your gene
C. A TE has inserted in the regulatory sequences for your gene, altering gene regulation.
D. A chromosomal breakage has occurred due to excision of a TE
C. A TE has inserted in the regulatory sequences for your gene, altering gene regulation.
In eukaryotic organisms, a functional eukaryotic protein is typically made up of the information contained within what region of pre-mRNA?
A. introns
B. enhancers
C. exons
D. promoters
C. exons
Which modifications are typically found on eukaryotic mRNAs?
A. Eukaryotic mRNAs are not modified before translation
B. Addition of poly A only
C. Capping only
D. Capping and poly-A addition
D. Capping and poly-A addition
A gene that undergoes rho-dependent termination has a mutation in the rut site. How will this influence transcriptional activity?
A. Transcription will terminate normally as Rho termination relies on the rut site to enhance termination; it is not essential for termination.
B. Transcription will stop immediately because RNA polymerase will sense there is a mutation.
C. Transcription will continue until another termination sequence is reached, either Rho-dependent or independent.
D. There will be no influence
C. Transcription will continue until another termination sequence is reached, either Rho-dependent or independent.
If the piece of partially double-stranded DNA below was added to a reaction mixture that contained DNA pol III and all the reaction components necessary to synthesize DNA, what would be the next base added?
5’ AGCATGACGATCCAT 3’
3’ ACTGCTAG 5’
A. A
B. G
C. T
D. C
C. T
You are studying DNA replication in human cells. You discover a mutant cell line that can carry out DNA replication, but the final product contains both RNA and DNA fragments. What enzyme is likely to be missing in this cell line?
A. DNA helicase
B. DNA polymerase I
C. DNA ligase
D. flap endonuclease
D. flap endonuclease
Based on their known functions, which of the enzymes in the following pairs play a similar role in prokaryotes and eukaryotes?
A. DNA pol II : DNA pol β
B. DNA pol III : DNA pol γ
C. DNA pol I : DNA pol α
A. DNA pol II : DNA pol β
In a double-helix DNA strand, the adenine on one strand forms a hydrogen bond with a(n) ____ on the other strand.
A.thymine
B.guanine
C.adenine.
D.cytosine
A. thymine
You are performing an experiment to identify chromosome territories in a species with 6 pairs of homologous chromosomes, plus two sex chromosomes. You use 7 different colored fluorescent molecules (one for each chromosome and one for the sex chromosome) and link each one to a probe that is highly conserved at the centromere of each chromosome in this species. What will be the result of your experiment?
A. The chromosomes will all be marked but you won’t be able to tell which chromosome is which.
B. You will be able to identify the location and identity of each chromosome territory.
C. The chromosomes will all be marked with the same color.
D. None of the probes will bind to the chromosomes.
A. The chromosomes will all be marked but you won’t be able to tell which chromosome is which.
If a eukaryotic organism is missing the U5 snRNP, it will have trouble performing which step of splicing?
A.Formation of the intron loop
B.Exon degradation
C.Binding of snRNPs to the 5’ splice site
D.Binding of snRNPs to the branch site
A. Formation of the intron loop
This pre-mRNA contains 8 exons and 7 introns. The splice sites surrounding exon 4 are not readily recognized by the splicesome. In addition, a splicing repressor prevents the recognition of the 3’ splice site in exon 7. What exons will be present in the mature mRNA?
A.1, 2, 3, 5, 6, 7, 8
B.1, 2, 3, 4, 5, 6, 7, 8
C.1, 2, 3, 4, 5, 6, 8
D.1, 2, 3, 5, 6, 8
E.1, 2, 3, 5, 6
D. 1, 2, 3, 5, 6, 8
RNA polymerase I in eukaryotes produces which type of RNA?
A. snRNA
B. tRNA
C. 18S rRNA
D. 5S rRNA
C. 18S rRNA
The scientist(s) __________ studied Neurospora mutants that were altered in their nutritional requirements and hypothesized that one gene encodes one enzyme.
A. Beadle and Tatum
B Nirenberg and Leder
C. Khorana and colleagues
D. Nirenberg and Matthaei
A. Beadle and Tatum
RF1 and RF2 are active during _______.
A. initiation
B. termination
C. elongation
D. cotranslational import
B. termination
Which of the following codons is NOT degenerate to CUU?
A. UUG
B. CUC
C. AUU
D. UUA
E. CUA
C. AUU
The scientist(s) __________ created a cell-free translation system. An mRNA template was added to a number of tubes, each containing amino acids with a different one radiolabeled. Radiation was measured from the precipitated protein, and this corresponded to the mRNA template that had been added. This was the first experiment that demonstrated the ability to synthesize polypeptides from synthetic mRNA, and revealed a relationship between the two.
A. Khorana and colleagues
B. Beadle and Tatum
C. Nirenberg and Matthaei
D. Garrod
C. Nirenberg and Matthaei
What does eIF5 act to recruit during the initiation stage?
A. the large ribosomal subunit
B. the 7-methylguanosine cap
C. the mRNA
D. the polypeptide
E. termination GTPases
A. the large ribosomal subunit
Which of the following is NOT a stop codon?
A. UGA
B. UAG
C. UAA
D. UUA
D. UUA
Select the statement that is true regarding tRNA processing in E. coli.
A. RNaseP acts as an endonuclease.
B. RNaseD acts as an endonuclease.
C. The recognition sequence of RNaseD is 3’CCA5’.
D. The action of RNaseP produces the correct 3’ end of the mature tRNA.
A. RNaseP acts as an endonuclease.
Kozak’s rules for translation are similar to those for transcription in prokaryotes in that they both contain consensus sequences. In prokaryotes, the promoter consensus sequences are at −35 and −10. Where is the consensus sequence for translational initiation according to Kozak’s rules?
A. −12 to −2
B. −35 to −10
C. +1 to +10
D. −6 to +4
D. −6 to +4
Which of the following would be considered an activated amino acid?
A. Amino acid · ATP · aminoacyl-tRNA synthetase
B. Amino acid · AMP
C. Amino acid · aminoacyl-tRNA synthetase
D. Amino acid · AMP · PPi
B. Amino acid · AMP
You perform a cell-free translation experiment like Nirenberg and Matthaei. You start with 60% C and 40% A. What relative amount of radiolabeled proline do you expect in the translated polypeptides?
A) 14%
B) 28%
C) 36%
D) 22%
C) 36%
The C-terminus of a polypeptide always contains
A. Methionine.
B. carbon dioxide.
C. a stop amino acid.
D. a carboxyl group.
E. an amino group.
F. a stop codon.
D. a carboxyl group.
What site does the initiator tRNA bind to on the ribosome?
A. P
B. E
C. A
A. P
What is responsible for binding the initiator tRNA in prokaryotes and eukaryotes?
A) EF-G / eEF2
B) RF3 / eRF3
C) EF-Tu / eEF1α
D) IF2 / eIF2
D) IF2 / eIF2
DNA differs from RNA in which way?
A) the structure of the nucleotide
B) the number of bases attached to the sugar
C) the size of the phosphate groups
D) the five-carbon sugar it uses
D) the five-carbon sugar it uses
A double stranded stretch of eukaryotic DNA is 250,000 bp long. If the average linker is about 54 base pairs, how many nucleosomes would be present on this piece of DNA?
A) 1712
B) 1250
C) 200
D) 4630
B) 1250
The majority of the nonrepetitive genes in an organism are found in which of the following?
A. unique sequences
B. moderately repetitive sequences
C. highly repetitive sequences
D. None of these choices are correct.
A. unique sequences
The first group of researchers to correctly identify the double-helix structure of DNA were _______.
A. McClintock and Franklin
B. Pauling and Avery
C. Watson and Crick
D. Hershey and Chase
C. Watson and Crick
You have discovered a strain of E. coli that grows very slowly—the generation time is nearly 12 hours compared to the normal 20-30 minutes. Upon further investigation, you find a mutation in a gene for one of the subunits of DNA polymerase III. What subunit is this mutation most likely to be in?
A. γ
B. α
C. δ
D. β
D. β
you identify a drug that specifically blocks exonuclease activity. When you add it at the appropriate time to an in vitro system that carries out all the stages of eukaryotic transcription, you find that transcription proceeds normally, but transcription doesn’t terminate. This experiment provides support for which model of eukaryotic transcriptional termination?
A) Rho-dependent termination
B) Torpedo model
C) Allosteric model
D) Rho-independent termination
B) Torpedo model
If translation begins at the first start codon and ends at the first in frame stop codon, how many amino acids are encoded by the following mRNA?
5′GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3′
A.8
B.10
C.11
D.9
A.8
You perform a cell free translation experiment like Nirenberg and Matthaei, but you forget to write down what nucleotides you added to make the mRNA. You precipitate the translated polypeptides and measure the relative amount of radiolabeled amino acids incorporated into them. You get 25% proline, 25% threonine, 12.5% glutamine, 12.5% lysine, 12.5% asparagine, and 12.5% histidine. What nucleotides and in what % did you add to make the mRNA?
A. 50% C and 50% U
B. 50% A and 50% G
C. 50% C and 50% A
C. 50% C and 50% A
Francis Crick proposed the adaptor hypothesis, and later the adaptor was discovered to be ______.
A. micro RNA
B. amino acid
C. mRNA
D. tRNA
E. siRNA
D. tRNA
The scientist(s) __________ developed a novel method to synthesize RNA. Short RNAs of 2 to 4 nucleotides were linked together to create a copolymer. The resulting peptide created after translation revealed the 3-letter code for the amino acids.
A. Khorana and colleagues
B. Garrod
C. Nirenberg and Leder
D. Beadle and Tatum
E. Nirenberg and Matthaei
A. Khorana and colleagues
The pyrimidine bases are _______
a. cytosine, thymine, and uracil
b. adenine and thymine
c. adenine and guanine
d. cytosine and guanine
a. cytosine, thymine, and uracil
Which of the following is a left-handed DNA molecule?
a. B DNA
b. R DNA
c. A DNA
d. Z DNA
d. Z DNA
What is the minimal number of tRNAs that can be used to recognize all of the codons for threonine?
a. 4
b. 3
c. 1
d. 2
d. 2
The proofreading of the DNA occurs in the _________.
a. both directions
b. 3′ to 5′ direction
c. 5′ to 3′ direction
b. 3′ to 5′ direction
Transposons that use an RNA intermediate for transposition are called _____.
A) RNAi transposons
B) R elements
C) retrotransposons
D) reverse transposons
C) retrotransposons
A protein called actin consists of 376 amino acids. The mRNA for actin must be longer than
A. 1128 nucleotides.
B. 125 nucleotides.
C. 376 nucleotides.
D. 3384 nucleotides.
A. 1128 nucleotides.
