Exam Review Unit 4

Question 1

Nucleotides in DNA

Answer 1

A, T, C, G

Question 2

Nucleotides in RNA

Answer 2

A, U, C, G

Question 3

Sugar in DNA

Answer 3

Deoxyribose

Question 4

Sugar in RNA

Answer 4

Ribose

Question 5

Structure of DNA

Answer 5

Double Helix

Question 6

Structure of RNA

Answer 6

Single Strand

Question 7

Location of DNA in the cell

Answer 7

Nucleus

Question 8

Location of RNA in the cell

Answer 8

Nucleus and Cytoplasm

Question 9

DNA Replication:

Answer 9

• Occurs during S phase of interphase before mitosis and meiosis
• Happens in nucleus
• Doubles DNA so that when cell divides every cell ends up with the right amount
• Semi-conservative because the end result is half the original strand and half new

Question 10

List the 5 steps of DNA replication:

Answer 10

1. Helicase unzips DNA
2. Primase makes short RNA primers for DNA polymerase to get started
3. DNA polymerase brings in complementary base pairs, using the 3’ – 5’ strand as a template. Then replaces RNA primers and double checks.
4. DNA ligase seals the gap.
5. 2 new identical DNA strands are made.

Question 11

Protein Synthesis

Answer 11

• Occurs all of the time because the cell is always using proteins
• uses transcription and translation

Question 12

Transcription:

Answer 12

DNA 🡪 mRNA, occurs in nucleus

Question 13

List the 4 steps of transcription

Answer 13

1. Section of DNA (gene) is unzipped
2. RNA Polymerase brings in complementary RNA base pair rules
3. mRNA (messenger) strand is released to leave the nucleus
4. DNA zips back up

Question 14

Translation:

Answer 14

mRNA 🡪 protein, occurs in ribosome

Question 15

List the 5 steps of translation

Answer 15

1. mRNA attaches to ribosome
2. Message is read beginning at start codon “AUG”
3. tRNA bring corresponding amino acids
4. Amino acids bonded together with peptide bonds
5. Keeps reading the mRNA in 3’s (codons) until it reaches the “stop” codon and releases the completed protein

Question 16

REPLICATE the DNA strand below:

AGCATACAAACACTTATTCATC

Answer 16

TCGTATGTTTGTGAATAAGTAG

Question 17

TRANSCRIBE and TRANSLATE the DNA strand below (look at notes for translator):

AGCATACAAACACTTATTCATC

Answer 17

UCGUAUGUUUGUGAAUAAGUAG

Met – Phe – Val – Asp – Lys - stop

Question 18

Gametes

Answer 18

Sex cells; egg and sperm; haploid; result from meiosis

Question 19

Somatic Cells

Answer 19

Body cells; diploid; result from mitosis

Question 20

Haploid

Answer 20

1 full set of chromosomes (n)

Question 21

Diploid

Answer 21

2 full sets of chromosomes (2n)

Question 22

Homologous Chromosomes

Answer 22

Similar chromosomes, one from mom and one from dad, with genes located in the same place

Question 23

Sister Chromatids

Answer 23

Identical copies of the same chromosome that result after DNA replication

Question 24

Crossing Over

Answer 24

Process in Prophase I of meiosis where homologous chromosome pairs swap pieces of DNA, creating new gene combinations

Question 25

What is Mitosis

Answer 25

Creation of diploid somatic cells

Question 26

When does Mitosis occur

Answer 26

Throughout your life

Question 27

Where does Mitosis occur

Answer 27

Throughout body

Question 28

Why does Mitosis occur

Answer 28

For growth and repair

Question 29

How does Mitosis occur

Answer 29

PMAT once

Question 30

what is the result of Mitosis

Answer 30

2 identical diploid somatic cells

Question 31

What type of reproduction is Mitosis

Answer 31

Asexual

Question 32

What is Meiosis

Answer 32

Creation of haploid sex cells

Question 33

When does Meiosis occur

Answer 33

Females: before you are born; Males: throughout life

Question 34

Where does Meiosis occur

Answer 34

In ovaries and testes

Question 35

Why does Meiosis occur

Answer 35

To make babies

Question 36

How does Meiosis occur

Answer 36

PMAT twice

Question 37

What is the result of Meiosis

Answer 37

4 unique haploid gametes

Question 38

What type of reproduction is Meiosis

Answer 38

Sexual

Question 39

In normal humans, sex cells contain the _________ number of chromosomes.

Answer 39

Haploid