exam 2 clicker Q's Flashcards
How does the presence of high ATP affect the activity of the enzyme phosphofructokinase? A. The activity is lowered B. The activity is unchanged C. The activity is raised D. All of the above could be correct.
C
Methotrexate is a chemotherapy drug. It is structurally similar to the coenzyme folate which binds to the
enzyme dihydrofolate reducatase. This enzyme is part of the synthesis of DNA and RNA, and when methotrexate binds the enzyme, it renders it inactive by blocking folate, so it cannot synthesize DNA and RNA. Thus, the cancer cells are unable to grow and divide. What kind of regulation is it?
• A. Allosteric activation
• B. Allosteric inhibition
• C. Competitive inhibition
• D. Non-competitive allosteric inhibition
C
An early experiment: out of what material does a plant create its matter? A. The Soil B. Water C. The Air D. Microbes
C
What has been the largest source of energy for human cultural evolution? • A. Nuclear Power • B. Renewable energy • C. Animal Power • D. Fossil Fuels
D
What has been the largest source of energy for human cultural evolution? • A. Nuclear Power • B. Renewable energy • C. Animal Power • D. Fossil Fuels
D
What is the name of the photosynthetic organelle of plants? • A. Mitochondria • B. Midi-chlorian • C. Chloroplast • D. Gastrula
C
Photosystem II pulls electrons from _____, resulting in the production of oxygen and protons on the lumen side of the membrane. Photosystem I passes electrons to ______, producing ______ for use in the Calvin cycle.
• A. NADH; ATP; Rubisco
• B. water; NADP+; NADPH
• C. Chlorophyll; water; NADPH
• D. the lumen; the thylakoid; chloroplasts
B
Early photosystems may have used something like \_\_\_\_\_ as an electron donor instead of water. • A. ATP • B. NADPH • C. Chlorophyll • D. H2S
D
The accumulation of protons in the thylakoid \_\_\_\_\_\_\_ drives the production of \_\_\_\_\_ • A. chloroplast; NADH • B. lumen; ATP • C. Pigment; Rubisco • D. Mitochondria; PGAL
B
What is the spectrum of light that chlorophyll can harvest?
• A. Shorter than 400 nm
• B. Longer than 700 nm
• C. Between 400 and 700 nm • D. Longer than 12,000 nm
C
When NADP+ gains an electron (in the form of an H) is this reduction or oxidation of the NADP+?
• A. Oxidation
• B. Reduction
B
What is the most common protein (enzyme) on earth by weight? • A. RNA polymerase I • B. RNA polymerase V • C. Rubisco • D. Helicase
C
Photorespiration is the loss of efficiency of the
Calvin cycle when Rubisco acts on ______ instead
of _______
• A. RuBP; CO2
• B. RuBP; O2
• C. O2; CO2
• D. CO2; O2
C
Carotenoids are…
• A. Used by plants in photosynthesis
• B. Beneficial compounds in a human diet
• C. Responsible for the beautiful fall colors of leaves on trees
• D. All of the above
D
What kind of signal would it be? A compound emitted by the gonads and adrenal glands diffuses throughout the body causing sex-specific body development. Male organisms tend to produce more of this substance. • A. Intracrine • B. Paracrine • C. Endocrine • D. Pheromonal
C
What kind of signal would it be? A compound emitted internally in a cell causes changes to the behavior of the cell itself. • A. Intracrine • B. Paracrine • C. Endocrine • D. Pheromonal
A
What kind of signal would it be? A compound emitted in a termite colony by the queens suppresses the ovary development in female worker termites to prevent them from reproducing. • A. Intracrine • B. Paracrine • C. Endocrine • D. Pheromonal
D
What kind of receptor is it? In response to the binding of a neurotransmitter, this protein complex opens a channel in the membrane – allowing the flow of Calcium ions into the cell.
• A. G protein-coupled receptor • B. Receptor kinase
• C. Ligand-gated ion channel
• D. Any of the above
C
How many chromatids do humans have before S-phase in each somatic cell of their body? • A. 23 • B. 46 • C. 92 • D. 12 or 13
B
At the end of meiosis, how many sperm are created from one parent cell? • A. 1 • B. 4 • C. 8 • D. 16
B
At the end of meiosis, how many functioning eggs are created from one parent cell? • A. 1 • B. 4 • C. 8 • D. 16
A
Which of the following is true of cancer cells?
• A. A cancer cell will undergo apoptosis as any normal cell would.
• B. All cancer cells have the ability to migrate to other parts of the
body through the process of angiogenesis.
• C. Cancer cells do not stop dividing even if they are overcrowded.
• D. A cancer cell will remain the G0 phase indefinitely.
C
Which of the following is true regarding cell cycle regulators?
A. Different cyclins send a Cdk to different targets.
B. Levels of cyclins can change dramatically across the cell cycle.
C. When a cyclin partners with a Cdk, it inactivates the Cdk.
D. A Cdk is a DNA repair enzyme.
A,B
Which of the following accurately compares tumor suppressor genes and proto-oncogenes?
A. Both tumor suppressor and proto-oncogenes prevent the spread of cancer by targeting and destroying existing cancer cells.
B. A person who has both tumor suppressor and proto-oncogenes will always develop cancer.
C. Proto-oncogenes code for growth factors, while tumor suppressor genes inhibit cell division of damaged cells.
D. When a proto-oncogene mutates, it becomes a tumor suppressor gene.
C
Which of the following explains how apoptosis is related to cancer?
A. The cues that would trigger apoptosis have failed in cancer cells.
B. Cancer cells cause excessive apoptosis in surrounding cells to make room for more cancer cell growth.
C. Cancer is an example of uncontrolled apoptosis.
D. Cancer cells are formed when necrosis occurs instead of apoptosis.
A
Which of the following observations tells a
scientist that the organism she is observing is a
eukaryote?
• A. The organism has ribosomes
• B. The organism has a membrane bound nucleus
• C. The organism is unicellular
• D. The organism has a cell membrane
B
In which direction are new DNA strands built (on the new strands themselves – not the template strand)? • A. In the 5’ to 3’ direction • B. In the 3’ to 5’ direction
A
An \_\_\_\_\_\_\_\_\_is needed to begin synthesis on a new strand of DNA. This piece allows the DNA polymerase to come in and begin its work. • A. Topoisomerase • B. Ligase • C. RNA polymerase • D. RNA primer
D
A DNA \_\_\_\_\_\_joins the DNA fragments in the lagging strand. This also joins up the multiple sections of replicating DNA within the chromosome. • A. Topoisomerase • B. Ligase • C. RNA polymerase • D. RNA primer
B
\_\_\_\_\_\_\_\_\_\_\_\_\_\_relieves stress on the double helix that results from unwinding. • A. Topoisomerase • B. Ligase • C. RNA polymerase • D. RNA primer
A
Which strand is the template strand?
A
5’ ATAGCTAGTCCTATAAAGGGCAAAAGCCCGGATGCATCGCGCGGGCCA 3’
B
3’ TATCGATGAGGATATTTCCCGTTTTCGGGCCTACGTAGCGCGCCCGGT 5’
B
What direction will transcription go in? Right or left?
5’ ATAGCTAGTCCTATAAAGGGCAAAAGCCCGGATGCATCGCGCGGGCCA 3’
3’ TATCGATGAGGATATTTCCCGTTTTCGGGCCTACGTAGCGCGCCCGGT 5’
A. To the right
B. To the left
A
Which mutation below would likely be the most dramatic in its effects?
GCU ACG GAG CUU CGG AGC UAG (Original sequence)
CGC UAC GGA GCU UCG GAG CUA G (single base insertion)
GCU UAG GAG CUU CGG AGC UAG (stop codon insertion)
GCU CAG ACG GAG CUU CGG AGC UAG (three base insertion)
A. The single base insertion
B. The stop codon
C. Both the single base insertion and the stop codon
D. The three base insertion and the stop codon
C
Do humans have variability in their protein-
coding DNA and mRNA (and thus variability in
some of their proteins)?
• A. Yes.
• B. No.
A
5. From an animal’s perspective, what is the most important by-product of photosynthesis? • A. Oxygen • B. Carbon Dioxide • C. Carbohydrate foods • D. Nitrogen fixation
A, C
2. How many chromatids do humans have after S- phase in each somatic cell of their body? • A. 23 • B. 46 • C. 92 • D. 12 or 13
C
- Where is the TATA box promoter? Strand A or strand B?
A
5’ ATAGCTAGTCCTATAAAGGGCAAAAGCCCGGATGCATCGCGCGGGCCA 3’
B
3’ TATCGATGAGGATATTTCCCGTTTTCGGGCCTACGTAGCGCGCCCGGT 5’
Both
