DNA RNA and Protein Synthesis Flashcards
Describe the structure of a eukaryotic chromosome
Describe the structure of a eukaryotic chromosome
Eukaryotic chromosomes are threadlike structures made up of a long molecule of DNA wound around proteins called histones the DNA and proteins are then coiled up to form a chromosome
Describe how DNA in prokaryotic chromosomes differs from DNA in eukaryotic chromosomes
Describe how DNA in prokaryotic chromosomes differs from DNA in eukaryotic chromosomes
DNA in prokaryotic chromosomes is shorter than DNA in eukaryotic chromosomes and is also circular rather than linear also the DNA isn’t wound around histone proteins
What is a gene?
What is a gene?
Sequence of DNA bases that codes for either a polypeptide or functional RNA
What is a cells genome?
What is a cells genome?
The complete set of genes in the cell
What is a cells proteome?
What is a cells proteome?
The full range of proteins that the cell can produce
Name two types of non-coding DNA
Name two types of non-coding DNA
Introns and multiple repeats
Name the sections within genes that code for amino acids
Name the sections within genes that code for amino acids
Exons
What is an allele?
What is an allele?
A different form of a gene
Alleles for the same characteristic can be found at a particular fixed point on a chromosome
what is the name given to this fixed point
Alleles for the same characteristic can be found at a particular fixed point on a chromosome
what is the name given to this fixed point
Locus
What role does mRNA play in protein synthesis
What role does mRNA play in protein synthesis
mRNA carries the genetic code from the DNA to the ribosomes
What is an mRNA codon?
What is an mRNA codon?
A Group of three adjacent bases on an mRNA molecule
What does mRNA stand for
What does mRNA stand for
Messenger RNA
What does tRNA stand for
What does tRNA stand for
Transfer RNA
Alpha amanitin Is a deadly toxins produced by some mushrooms it works by inhibiting RNA polymerase.
what effect will this have on protein synthesis? Explain your answer.
Alpha amanitin Is a deadly toxins produced by some mushrooms it works by inhibiting RNA polymerase.
what effect will this have on protein synthesis? Explain your answer.
It will inhibit protein synthesis.
by inhibiting RNA polymerase the toxin will prevent the transcription of mRNA from DNA preventing protein synthesis from taking place
Write down the sequence of this MRN a molecule
TCAAGCTCGGCTACGAGC
Write down the sequence of this MRN a molecule
TCAAGCTCGGCTACGAGC
UCAAGCUCGGCUACGAGC
Diamond-Blackfan anaemia is an inherited condition caused by one several gene mutations. The mutations can affect the function of the proteins that make up ribosomes
What effect could this have on protein synthesis? Explain
Diamond-Blackfan anaemia is an inherited condition caused by one several gene mutations. The mutations can affect the function of the proteins that make up ribosomes
What effect could this have on protein synthesis?
It may affect the function of the ribosomes, preventing them from translating mRNA into amino acids which could prevent protein synthesis
An error occurs during transcription that accidental inserts a stop signal into the middle of an mRNA sequence.
What effect could this have on the protein that is eventually produced? Explain
An error occurs during transcription that accidental inserts a stop signal into the middle of an mRNA sequence.
What effect could this have on the protein that is eventually produced? Explain
It could result in a shorter amino acid sequence being produced, which would change the primary structure of the protein and therefore the 3D tertiary structure of the protein
This could affect the proteins function. This could happen because translation of the mRNA sequence only continues until a stop signal is reached. Any codons after the stop signal would not be translated into amino acids.
Name the two stages of protein synthesis and state where each one takes place in eukaryotes
Name the two stages of protein synthesis and state where each one takes place in eukaryotes
Transcription takes places in the nucleus
Translation takes place at the ribosomes in the cytoplasm
What is RNA polymerase and which stage of protein synthesis is it involved in?
What is RNA polymerase and which stage of protein synthesis is it involved in?
An enzyme that is involved in transcription
Why is the mRNA that’s produced from a DNA template always a complementary copy of the DNA?
Why is the mRNA that’s produced from a DNA template always a complementary copy of the DNA?
Because of complementary base pairing
Explain why eukaryotic mRNA gets spliced
Explain why eukaryotic mRNA gets spliced
Eukaryotic DNA contains introns that don’t code for amino acids. These get transcribed into pre-mRNA along with the exons. Splicing removes the introns from pre-mRNA and joins together the exons to create mRNA ready for translation into a protein
Why does prokaryotic mRNA not undergo splicing?
Why does prokaryotic mRNA not undergo splicing?
It doesn’t contain introns
Describe the function of tRNA
Describe the function of tRNA
Carry amino acids to the ribosome during translation
What role does ATP play in translation?
What role does ATP play in translation?
ATP provides the energy needed for the bond between an amino acid and a tRNA molecule to form, allowing the tRNA to carry the amino acid to the ribosome
Explain how tRNA molecules pair up with mRNA during protein synthesis
Explain how tRNA molecules pair up with mRNA during protein synthesis
A tRNA molecule with an anticodon that’s complementary to a codon on the mRNA attached itself to the mRNA by complementary base pairing. A second tRNA molecule attaches itself to the next codon on the mRNA in the same way, and so on
What type of bond joins two amino acids together?
What type of bond joins two amino acids together?
Peptide bond
Give the DNA base sequence that would code for the following amino acid sequence:
Met - Phe - Gln - Gln - Ala -Tyr
mRNA codon Met - AUG Phe - UUU Gln - CAA Tyr - UAC Ala - GCG
Give the DNA base sequence that would code for the following amino acid sequence:
Met - Phe - Gln - Gln - Ala -Tyr
mRNA codon Met - AUG Phe - UUU Gln - CAA Tyr - UAC Ala - GCG
TACAAAGTTGTTCGCATGTAT
Describe the process of transcription in detail (4 marks)
Describe the process of transcription in detail (4 marks)
RNA polymerase attaches to the DNA double helix
The h bonds between the two dna strands break exposing some bases
One strand is used as a template
RNA polymerase line up free rna nucleotides alongside the exposed bases
Complementary base pairing means that the mRNA strand ends up being a complimentary copy of the template strand except the base T is replaced with U in rna
Polymerase joins the bases forming an mRNA strand
Polymerase moves down the dna strand
DNA reform when polymerase passes
Polymerase reches stop signal and moves out of nucleus attaches to a ribosome
A chemical called puromycin is believed to affect the development of rapid respiration in a freshly cut potato slice, by either affecting the synthesis of proteins or nucleic acids.
In an experiment, potato slices were kept in various concentrations of puromycin for 24 hours.
nucleic acid synthesis was monitored by radioactively tagging uracil and then measuring its uptake
Protein synthesis was monitored by radioactively tagging leucine and then measuring its uptake afterwards the percentage inhibition of the development of respiration, leucine uptake and uracil uptake were calculated the results are shown in the table below
Suggest why uracil was the only base that was radioactively tagged
A chemical called puromycin is believed to affect the development of rapid respiration in a freshly cut potato slice, by either affecting the synthesis of proteins or nucleic acids.
In an experiment, potato slices were kept in various concentrations of puromycin for 24 hours.
nucleic acid synthesis was monitored by radioactively tagging uracil and then measuring its uptake
Protein synthesis was monitored by radioactively tagging leucine and then measuring its uptake afterwards the percentage inhibition of the development of respiration, leucine uptake and uracil uptake were calculated the results are shown in the table below
Suggest why uracil was the only base that was radioactively tagged
uracil is present as a base in mRNA but not DNA so it’s used as a marker for RNA synthesis
The genetic code is described as non-overlapping what does this mean
The genetic code is described as non-overlapping what does this mean
Each triplet is read in sequence, separate from the triplet before it and after it – base triplets don’t share their bases
What is meant by the term start signal in mRNA
What is meant by the term start signal in mRNA
A base triplet that tells the cell when to start production of a particular protein
The same base triplet code for the same amino acids in all living things what word is used to describe this feature of the genetic code
The same base triplet code for the same amino acids in all living things what word is used to describe this feature of the genetic code
Universal
A species of bacteria has a gene that codes for the production of a blue coloured antibiotic
describe the role of RNA polymerase in the transcription of a gene sequence
the mRNA for the gene coding for the antibiotic is the same length as its DNA
explain how and why this might be different for a eukaryotic gene
A species of bacteria has a gene that codes for the production of a blue coloured antibiotic
describe the role of RNA polymerase in the transcription of a gene sequence
RNA polymerase lines up three RNA nucleotides alongside exposed bases on the DNA template strand.
the enzyme then moves along the DNA strand, assembling a complimentary mRNA sequence from the RNA nucleotides by joining them together
the mRNA for the gene coding for the antibiotic is the same length as its DNA
explain how and why this might be different for a eukaryotic gene
Genes in eukaryotic DNA contain introns which are sections that don’t code for amino acids. after transcription the introns are removed from pre-mRNA strands by splicing leaving only the exons, parts of the gene that codes for amino acids which form mRNA so eukaryotic mRNA would be shorter than the DNA it was transcribed from
Researchers have been studying the genetic code of a gene with the aim of developing a treatment for a particular genetic disease
what is the genetic code
the genetic code is described as universal and degenerate explain what these terms mean
Researchers have been studying the genetic code of a gene with the aim of developing a treatment for a particular genetic disease
what is the genetic code
The sequence of base triplets in mRNA which code for specific amino acids
the genetic code is described as universal and degenerate explain what these terms mean
It’s universal because the same specific base triplets code for the same amino acids in all living things
it is degenerate because there are more possible combinations of triplets and there are amino acids
Amino acid + DNA sequence Valine = CAG proline = GGA glutamine = GTT Histidine = GTG glycine = CCT serine = TCG alanine = CGT
Glycine - histidine - alanine - proline - histidine
Use the table to give the tRNA anticodons for the amino acid sequence shown above
Amino acid + DNA sequence Valine = CAG proline = GGA glutamine = GTT Histidine = GTG glycine = CCT serine = TCG alanine = CGT
Glycine - histidine - alanine - proline - histidine
Use the table to give the tRNA anticodons for the amino acid sequence shown above
CCU GUG CGU GGA GUG
Describe how the structure of tRNA differs from mRNA
Describe how the structure of tRNA differs from mRNA
tRNA is folded into a clover shape and held together by hydrogen bonds whereas mRNA is not
three adjacent bases in mRNA form a codon whereas tRNA has three specific bases called an anticodon
tRNA has an amino acid binding site whereas mRNA does not
The researchers are exploring a possible treatment for the genetic disease that would involve disrupting the process of translation
name the organelle that mRNA attaches to for translation to take place
Give a detailed description of tRNA’s role in translation
The researchers are exploring a possible treatment for the genetic disease that would involve disrupting the process of translation
name the organelle that mRNA attaches to for translation to take place
Ribosome
Give a detailed description of tRNA’s role in translation
tRNA molecules carry amino acid to the ribosome
a tRNA molecule with an anticodon that is complimentary to the first codon on the mRNA attaches itself to the mRNA by complimentary base pairing
a second tRNA molecule attaches itself to the next codon on the mRNA in the same way and the two amino acids are joined by a peptide bond the first tRNA molecule moves away, leaving its amino acid behind and this process continues and produces a polypeptide chain
Meiosis number of chromosomes
Meiosis number of chromosomes
2n
2 x 2n
2 x 2n
2 x 2n
2 x n 2 x n
n n n n
The diagram below shows to homologous chromosomes the red cross marks a point at which crossing over can occur
draw the chromosomes as they would be if crossing over occurred at this point
The diagram below shows to homologous chromosomes the red cross marks a point at which crossing over can occur
draw the chromosomes as they would be if crossing over occurred at this point
The diagram below shows a cell that contains three pairs of homologous chromosomes
draw a viable gamete that could be produced by the cell after meiosis
The diagram below shows a cell that contains three pairs of homologous chromosomes
draw a viable gamete that could be produced by the cell after meiosis
For each of the following sells state what stage the cell is that in meiosis choose from before meiosis l, between meiosis l and ll, or after meiosis ll
give a reason for each answer
For each of the following sells state what stage the cell is that in meiosis choose from before meiosis l, between meiosis l and ll, or after meiosis ll
give a reason for each answer
The graph below shows the average DNA content of a group of cells that are undergoing meiosis
describe what is happening:
between 10 hours and 40 hours
between 40 hours and 50 hours
between 50 and 55 hours
sketch a line on the graph to show what is likely to happen to the DNA content of the cell between 70 and 95 hours
The graph below shows the average DNA content of a group of cells that are undergoing meiosis
describe what is happening:
between 10 hours and 40 hours
between 40 hours and 50 hours
between 50 and 55 hours
sketch a line on the graph to show what is likely to happen to the DNA content of the cell between 70 and 95 hours
Are the following haploid or diploid?
Normal body cells ?
gametes ?
zygotes?
Are the following haploid or diploid?
Normal body cells - diploid
gametes - haploid
zygotes - diploid
Outline what happens in meiosis l and meiosis ll
Outline what happens in meiosis l and meiosis ll
Meiosis l - the homologous pairs separate
Meiosis ll - the sister chromatids separate
What are the two main events in meiosis that lead to genetic variation
Describe how each of these processes works
What are the two main events in meiosis that lead to genetic variation
Crossing over and independent segregation of chromosomes
Describe how each of these processes works
Crossing over results in chromosomes containing the same genes but a different combination of alleles which means that when the chromatids separate at meiosis ll, each of the four daughter cells will contain chromatids with different alleles
Independent segregation is when the random separation of homologous pairs in meiosis I means that different combinations of maternal and paternal chromosomes go into each cell which produces genetic variation in gametes
Give three differences in the outcomes of mitosis and meiosis
Give three differences in the outcomes of mitosis and meiosis
Mitosis produces cells with the same number of chromosomes as the parent cell, whereas meiosis produces cells with half the number of chromosomes as the parent cell
In mitosis daughter cells are genetically idental to each other and to the parent cell, whereas in meiosis daughter cells are genetically different from one another and the parent cell
Mitosis produces two daughter cells whereas meiosis produces four daughter cells
The diagram below shows the mutation of a different gene sequence. Explain why the mutation results in the same amino acid sequence.
Original gene: TATAGTGAG
Mutated gene: TACAGTGAG
The diagram below shows the mutation of a different gene sequence. Explain why the mutation results in the same amino acid sequence.
Original gene: TATAGTGAG
Mutated gene: TACAGTGAG
The genetic code is degenerate which means that some amino acids are coded for by more than one DNA triplet. In this example, TAT undergoes a substitution and becomes TAC. Both TAT and TAC code for tyrosine so the amino acid sequence produced stays the same
Edwards’ syndrome is caused by a person having an extra copy of chromosome 18.
Name the event during meiosis that causes a person to have an extra copy of a chromosome
Chromosome non disjunction
Explain how this event could lead to a person having an extra copy of chromosome 18
Non-disjunction would mean that chromosome 18 would fail to separate during meiosis so one cell gets an extra copy of 18 and another gets none. When the gamete with the extra copy fuses with another gamete at fertilisation, the resulting zygote will have three copies of chromosome 18
Complete the diagram below showing what would happen if the event took place during meiosis ll and explain what it shows briefly
Edwards’ syndrome is caused by a person having an extra copy of chromosome 18.
Name the event during meiosis that causes a person to have an extra copy of a chromosome
Explain how this event could lead to a person having an extra copy of chromosome 18
Complete the diagram below showing what would happen if the event took place during meiosis ll and explain what it shows briefly
What are gene mutations
What are gene mutations
Changes in the DNA base sequence of chromosomes
Which type of gene mutations will always lead to a change in the amino acid sequence
Which type of gene mutations will always lead to a change in the amino acid sequence
Deletion
What effect do mutagenic agents have on mutation and give an example of one
What effect do mutagenic agents have on mutation and give an example of one
They increase the rate of mutations occurring
Uv radiation, x-rays and gamma rays
A mutation of a tumour suppressor gene can result in the formation of a tumour. Explain how
(2 marks)
A mutation of a tumour suppressor gene can result in the formation of a tumour. Explain how
gene not able to slow down cell division;
Rate of cell division out of control
Not all mutations result in a change to the amino acid sequence of the encoded polypeptide.
Explain why.
Not all mutations result in a change to the amino acid sequence of the encoded polypeptide.
Explain why.
Genetic code degenerate;
Some cancer cells have a receptor protein in their cell-surface membrane that binds to a hormone called growth factor. This stimulates the cancer cells to divide.
Scientists have produced a monoclonal antibody that stops this stimulation.
Use your knowledge of monoclonal antibodies to suggest how this antibody stops the growth of a tumour.
Some cancer cells have a receptor protein in their cell-surface membrane that binds to a hormone called growth factor. This stimulates the cancer cells to divide.
Scientists have produced a monoclonal antibody that stops this stimulation.
Use your knowledge of monoclonal antibodies to suggest how this antibody stops the growth of a tumour.
Antibody has specific tertiary structure
Complementary to receptor protein
- Prevents GF binding (to receptor).
The diagram below represents one process that occurs during protein synthesis.
Name the process shown.
Identify the molecule labelled Q
The diagram below represents one process that occurs during protein synthesis.
Name the process shown.
Translation
Identify the molecule labelled Q
tRNA
the first codon is AUG. Give the base sequence of:
the complementary DNA base sequence
the missing anticodon
the first codon is AUG. Give the base sequence of:
the complementary DNA base sequence
TAC
the missing anticodon
UAC
The table below shows the base triplets that code for two amino acids.
Aspartic acid GAC, GAU
Proline CCA, CCG, CCC, CCU
Aspartic acid and proline are both amino acids. Describe how two amino acids differ from one another. You may use a diagram to help your description.
Have different R group
The table below shows the base triplets that code for two amino acids.
Aspartic acid GAC, GAU
Proline CCA, CCG, CCC, CCU
Aspartic acid and proline are both amino acids. Describe how two amino acids differ from one another. You may use a diagram to help your description.
The table below shows the base triplets that code for two amino acids.
Aspartic acid GAC, GAU
Proline CCA, CCG, CCC, CCU
Deletion of the sixth base (G) in the sequence shown in the diagram above would change the nature of the protein produced but substitution of the same base would not. Use the information in the table and your own knowledge to explain why.
The table below shows the base triplets that code for two amino acids.
Aspartic acid GAC, GAU
Proline CCA, CCG, CCC, CCU
Deletion of the sixth base (G) in the sequence shown in the diagram above would change the nature of the protein produced but substitution of the same base would not. Use the information in the table and your own knowledge to explain why.
Substitution would result in CCA / CCC / CCU
All code for same amino acid
Deletion will cause frame shift
Messenger RNA (mRNA) is used during translation to form polypeptides. Describe how mRNA is produced in the nucleus of a cell.
Messenger RNA (mRNA) is used during translation to form polypeptides. Describe how mRNA is produced in the nucleus of a cell.
Helicase breaks hydrogen bonds
only one DNA strand acts as a template
RNA nucleotides are attracted to exposed bases attraction according to base pairing rule RNA polymerase joins RNA nucleotides together
pre-mRNA spliced to remove introns
Describe the structure of proteins.
Describe the structure of proteins.
Polymer of amino acid is joined by peptide bonds formed by condensation
primary structure is order of the Amino acids secondary structure is folding of the polypeptide chain due to hydrogen bonding and ionic/disulphide bonds tertiary structure is 3-D folding due to hydrogen bonding and ionic disulphide bonds
Quaternary structure is two or more polypeptide chains
A large and growing number of disorders are now known to be due to types of mitochondrial disease (MD). MD often affects skeletal muscles, causing muscle weakness.
We get our mitochondria from our mothers, via the fertilised egg cell. Fathers
do not pass on mitochondria via their sperm. Some mitochondrial diseases 5 are caused by mutations of mitochondrial genes inside the mitochondria.
Most mitochondrial diseases are caused by mutations of genes in the cell
nucleus that are involved in the functioning of mitochondria. These mutations
of nuclear DNA produce recessive alleles.
One form of mitochondrial disease is caused by a mutation of a mitochondrial 10 gene that codes for a tRNA. The mutation involves substitution of guanine for adenine in the DNA base sequence. This changes the anticodon the tRNA.
This results in the formation of a non-functional protein in the mitochondrion.
There are a number of ways to try to diagnose whether someone has a mitochondrial disease. One test involves measuring the concentration of 15 lactate in a person’s blood after exercise. In someone with MD, the
concentration is usually much higher than normal. If the lactate test suggests
MD, a small amount of DNA can be extracted from mitochondria and DNA sequencing used to try to find a mutation.
Suggest how the change in the anticodon of a tRNA leads to MD (lines 10–13). Change to tRNA leads to wrong amino acid being incorporated into protein; Tertiary structure (of protein) changed; Protein required for oxidative phosphorylation so less / no ATP made.
A large and growing number of disorders are now known to be due to types of mitochondrial disease (MD). MD often affects skeletal muscles, causing muscle weakness.
We get our mitochondria from our mothers, via the fertilised egg cell. Fathers
do not pass on mitochondria via their sperm. Some mitochondrial diseases 5 are caused by mutations of mitochondrial genes inside the mitochondria.
Most mitochondrial diseases are caused by mutations of genes in the cell
nucleus that are involved in the functioning of mitochondria. These mutations
of nuclear DNA produce recessive alleles.
One form of mitochondrial disease is caused by a mutation of a mitochondrial 10 gene that codes for a tRNA. The mutation involves substitution of guanine for adenine in the DNA base sequence. This changes the anticodon the tRNA.
This results in the formation of a non-functional protein in the mitochondrion.
There are a number of ways to try to diagnose whether someone has a mitochondrial disease. One test involves measuring the concentration of 15 lactate in a person’s blood after exercise. In someone with MD, the
concentration is usually much higher than normal. If the lactate test suggests
MD, a small amount of DNA can be extracted from mitochondria and DNA sequencing used to try to find a mutation.
Suggest how the change in the anticodon of a tRNA leads to MD (lines 10–13).
Change to tRNA leads to wrong amino acid being incorporated into protein; Tertiary structure (of protein) changed; Protein required for oxidative phosphorylation so less / no ATP made.
The faulty allele that causes Ellis-van Creveld syndrome is the result of a mutation of a gene called EVC. This mutation leads to the production of a protein that has one amino acid missing.
(i) Suggest how a mutation can lead to the production of a protein that has one amino acid missing.
The faulty allele that causes Ellis-van Creveld syndrome is the result of a mutation of a gene called EVC. This mutation leads to the production of a protein that has one amino acid missing.
(i) Suggest how a mutation can lead to the production of a protein that has one amino acid missing.
Loss of 3 bases
Suggest how the production of a protein with one amino acid missing may lead to a genetic disorder such as Ellis-van Creveled syndrome
Suggest how the production of a protein with one amino acid missing may lead to a genetic disorder such as Ellis-van Creveled syndrome
Change in tertiary structure / active site;
So faulty
A mutation can lead to the production of a non-functional enzyme. Explain how.
A mutation can lead to the production of a non-functional enzyme. Explain how.
A mutation mutation in nucleotide sequence (of DNA / gene);
- Change in amino acid sequence;
- Change in hydrogen / ionic / disulfide bonds;
- Change in the tertiary structure / shape;
- Change in active site;
- Substrate not complementary so no enzyme-substrate complexes form.
One farmer stated that the increase in the use of Bt crop plants had caused a mutation in one of the insect species and that this mutation had spread to other species of insect. Was he correct? Explain your answer
One farmer stated that the increase in the use of Bt crop plants had caused a mutation in one of the insect species and that this mutation had spread to other species of insect. Was he correct? Explain your answer
There was a time lag between the introduction of Bt crops and the appearance of the first insect species that was resistant to the Bt toxin.
Explain why there was a time lag.
There was a time lag between the introduction of Bt crops and the appearance of the first insect species that was resistant to the Bt toxin.
Explain why there was a time lag.
Describe what happens in division one and two in meiosis
Describe what happens in division one and two in meiosis
Meiosis l - homologous pairs are separated reducing chromosome number by half
Meiosis ll - sister chromatids are separated producing four haploid gamers
What happens in late interphase
What happens in late interphase
Synapse and crossing over begin
What happens in prophase one
What happens in prophase one
Crossing over continues and paired chromosomes condense
Metaphase l
Metaphase l
Homologous chromosomes line up double file
Anaphase l / telophase l
Anaphase l / telophase l
Homologous chromosomes separate into haploid daughter cells; sister chromatids stay joined
Metaphase ll
Metaphase ll
Chromosomes line up single file in haploid cells
Anaphase ll / telophase ll
Anaphase ll / telophase ll
Sister chromatids separate into non-identical haploid cells
