DNA RNA and Protein Synthesis Flashcards
Describe the structure of a eukaryotic chromosome
Describe the structure of a eukaryotic chromosome
Eukaryotic chromosomes are threadlike structures made up of a long molecule of DNA wound around proteins called histones the DNA and proteins are then coiled up to form a chromosome
Describe how DNA in prokaryotic chromosomes differs from DNA in eukaryotic chromosomes
Describe how DNA in prokaryotic chromosomes differs from DNA in eukaryotic chromosomes
DNA in prokaryotic chromosomes is shorter than DNA in eukaryotic chromosomes and is also circular rather than linear also the DNA isn’t wound around histone proteins
What is a gene?
What is a gene?
Sequence of DNA bases that codes for either a polypeptide or functional RNA
What is a cells genome?
What is a cells genome?
The complete set of genes in the cell
What is a cells proteome?
What is a cells proteome?
The full range of proteins that the cell can produce
Name two types of non-coding DNA
Name two types of non-coding DNA
Introns and multiple repeats
Name the sections within genes that code for amino acids
Name the sections within genes that code for amino acids
Exons
What is an allele?
What is an allele?
A different form of a gene
Alleles for the same characteristic can be found at a particular fixed point on a chromosome
what is the name given to this fixed point
Alleles for the same characteristic can be found at a particular fixed point on a chromosome
what is the name given to this fixed point
Locus
What role does mRNA play in protein synthesis
What role does mRNA play in protein synthesis
mRNA carries the genetic code from the DNA to the ribosomes
What is an mRNA codon?
What is an mRNA codon?
A Group of three adjacent bases on an mRNA molecule
What does mRNA stand for
What does mRNA stand for
Messenger RNA
What does tRNA stand for
What does tRNA stand for
Transfer RNA
Alpha amanitin Is a deadly toxins produced by some mushrooms it works by inhibiting RNA polymerase.
what effect will this have on protein synthesis? Explain your answer.
Alpha amanitin Is a deadly toxins produced by some mushrooms it works by inhibiting RNA polymerase.
what effect will this have on protein synthesis? Explain your answer.
It will inhibit protein synthesis.
by inhibiting RNA polymerase the toxin will prevent the transcription of mRNA from DNA preventing protein synthesis from taking place
Write down the sequence of this MRN a molecule
TCAAGCTCGGCTACGAGC
Write down the sequence of this MRN a molecule
TCAAGCTCGGCTACGAGC
UCAAGCUCGGCUACGAGC
Diamond-Blackfan anaemia is an inherited condition caused by one several gene mutations. The mutations can affect the function of the proteins that make up ribosomes
What effect could this have on protein synthesis? Explain
Diamond-Blackfan anaemia is an inherited condition caused by one several gene mutations. The mutations can affect the function of the proteins that make up ribosomes
What effect could this have on protein synthesis?
It may affect the function of the ribosomes, preventing them from translating mRNA into amino acids which could prevent protein synthesis
An error occurs during transcription that accidental inserts a stop signal into the middle of an mRNA sequence.
What effect could this have on the protein that is eventually produced? Explain
An error occurs during transcription that accidental inserts a stop signal into the middle of an mRNA sequence.
What effect could this have on the protein that is eventually produced? Explain
It could result in a shorter amino acid sequence being produced, which would change the primary structure of the protein and therefore the 3D tertiary structure of the protein
This could affect the proteins function. This could happen because translation of the mRNA sequence only continues until a stop signal is reached. Any codons after the stop signal would not be translated into amino acids.
Name the two stages of protein synthesis and state where each one takes place in eukaryotes
Name the two stages of protein synthesis and state where each one takes place in eukaryotes
Transcription takes places in the nucleus
Translation takes place at the ribosomes in the cytoplasm
What is RNA polymerase and which stage of protein synthesis is it involved in?
What is RNA polymerase and which stage of protein synthesis is it involved in?
An enzyme that is involved in transcription
Why is the mRNA that’s produced from a DNA template always a complementary copy of the DNA?
Why is the mRNA that’s produced from a DNA template always a complementary copy of the DNA?
Because of complementary base pairing
Explain why eukaryotic mRNA gets spliced
Explain why eukaryotic mRNA gets spliced
Eukaryotic DNA contains introns that don’t code for amino acids. These get transcribed into pre-mRNA along with the exons. Splicing removes the introns from pre-mRNA and joins together the exons to create mRNA ready for translation into a protein
Why does prokaryotic mRNA not undergo splicing?
Why does prokaryotic mRNA not undergo splicing?
It doesn’t contain introns
Describe the function of tRNA
Describe the function of tRNA
Carry amino acids to the ribosome during translation
What role does ATP play in translation?
What role does ATP play in translation?
ATP provides the energy needed for the bond between an amino acid and a tRNA molecule to form, allowing the tRNA to carry the amino acid to the ribosome
Explain how tRNA molecules pair up with mRNA during protein synthesis
Explain how tRNA molecules pair up with mRNA during protein synthesis
A tRNA molecule with an anticodon that’s complementary to a codon on the mRNA attached itself to the mRNA by complementary base pairing. A second tRNA molecule attaches itself to the next codon on the mRNA in the same way, and so on
What type of bond joins two amino acids together?
What type of bond joins two amino acids together?
Peptide bond
Give the DNA base sequence that would code for the following amino acid sequence:
Met - Phe - Gln - Gln - Ala -Tyr
mRNA codon Met - AUG Phe - UUU Gln - CAA Tyr - UAC Ala - GCG
Give the DNA base sequence that would code for the following amino acid sequence:
Met - Phe - Gln - Gln - Ala -Tyr
mRNA codon Met - AUG Phe - UUU Gln - CAA Tyr - UAC Ala - GCG
TACAAAGTTGTTCGCATGTAT
Describe the process of transcription in detail (4 marks)
Describe the process of transcription in detail (4 marks)
RNA polymerase attaches to the DNA double helix
The h bonds between the two dna strands break exposing some bases
One strand is used as a template
RNA polymerase line up free rna nucleotides alongside the exposed bases
Complementary base pairing means that the mRNA strand ends up being a complimentary copy of the template strand except the base T is replaced with U in rna
Polymerase joins the bases forming an mRNA strand
Polymerase moves down the dna strand
DNA reform when polymerase passes
Polymerase reches stop signal and moves out of nucleus attaches to a ribosome
A chemical called puromycin is believed to affect the development of rapid respiration in a freshly cut potato slice, by either affecting the synthesis of proteins or nucleic acids.
In an experiment, potato slices were kept in various concentrations of puromycin for 24 hours.
nucleic acid synthesis was monitored by radioactively tagging uracil and then measuring its uptake
Protein synthesis was monitored by radioactively tagging leucine and then measuring its uptake afterwards the percentage inhibition of the development of respiration, leucine uptake and uracil uptake were calculated the results are shown in the table below
Suggest why uracil was the only base that was radioactively tagged
A chemical called puromycin is believed to affect the development of rapid respiration in a freshly cut potato slice, by either affecting the synthesis of proteins or nucleic acids.
In an experiment, potato slices were kept in various concentrations of puromycin for 24 hours.
nucleic acid synthesis was monitored by radioactively tagging uracil and then measuring its uptake
Protein synthesis was monitored by radioactively tagging leucine and then measuring its uptake afterwards the percentage inhibition of the development of respiration, leucine uptake and uracil uptake were calculated the results are shown in the table below
Suggest why uracil was the only base that was radioactively tagged
uracil is present as a base in mRNA but not DNA so it’s used as a marker for RNA synthesis