control of gene expression topic 8 Flashcards
when does gene mutation normally occur
during DNA replication
what are the types of mutations
addition
deletion
substituition
inversion
duplication
translocation
what is inversion
a sequence of bases is reversed
what is duplication
when one or more bases is repeated
e.g ACTG becomes ACTCTG
what is translocation
a sequence of bases is moved from one location of the genome to another
what do mutagenic agents do
they increase the rate of mutation
what are examples of mutagenic agents
uv radiation
ionising radiation
some viruses
why is it an advantage that genetic code is degenerate
if a mutation occurs it may not change the proteins amino acid sequence
since they code for the same amino acid
what is a frame shift
a change in all the following base triplets
why are muscle cells different to hair cells
muscle cell has same DNA as a hair cell
but different portions of DNA is translated which makes the cells different
what is a stem cell
they are the types of cells which can differentiate into many kinds of cells
what are the different types of stem cells
totipotent
pluripotent
unipotent
induced pluripotent
what is a totipotent cell
they can divide to produce any type of body cell
they go on to develop but only translate a portion of the DNA
found in short term embryos
what are pluripotent cells
stem cells found in embryo but can differentiate into fewer cells than totipotent
what are unipotent cells
stem cells that can differentiate into only one kind of cell
e.g cardiac stem cells can only differentiate into cardiomyocytes
what are induced pluripotent stem cell
can be produced from adult somatic stem cells
That has the properties of pluripotent stem cell
can be done adding appropriate protein transcription factor
how can the transcription of target genes be stimulated
occurs due to transcription factors move from the cytoplasm to the nucleus
once in the nucleus ,they bind to specific DNA sites near the target genes
this has the effect of activating transcription / repressing transcription
describe how steroid oestrogen stimulates transcription
1.The lipid soluble nature of oestrogen means that it can diffuse across the cell membrane where it binds to a receptor molecule on a transcription factor
2.The binding alters the shape of DNA binding site on a transcription factor and makes it easy to bind to DNA
3.The transcription factor therefore enters the nucleus via nuclear pore where it binds to DNA . This stimulates the transcription of the gene that makes up the DNA
what is epigenetics
involves heritable changes in gene function ,without changes to the base sequence of DNA
determines whether the gene is switched off or switched on by changing how easily the gene can be transcribed
how can you ‘switch off’ of a gene
when more methyl groups are added to the DNA
making it harder to transcribe
how can you switch on a gene
when you add more acetyl groups to the DNA
How can epigenetics lead to the development of genetic disease
fragile X ray syndrome is a condition where there is increased methylation of FMR 1 gene due to deletion mutation
causing gene to be switched off and the protein it codes for ,to not be produced
what is si RNA interference
they inhibit the translation of the mRNA produced from target genes
what is responsible for RNA interference
miRNA and siRNA
how does siRNA inhibit translation
1 .siRNA binds to complementary sequence of mRNA
2. Cell detects it as abnormal since mRNA is single stranded
3 .mRNA is bricked down by enzymes preventing translation
what is a tumour
a mass of abnormal cells
what are the two types of tumours
benign -not cancerous ,they grow slowly and are often harmless
malignant - grow rapidly and invade surrounding tissues
what causes tumours
changes to genes called tumour suppressor genes and proto-oncogenes
- if many methyl groups/acetyl bind to tumour suppressor genes/proto-oncogenes ,it becomes harder to transcribe the gene
- mitosis isn’t regulated
- leads to cancer
what are the two types of genes involved in the production of tumours
tumour suppressor gene
proto-oncogene
what causes breast cancer
increase concentration of oestrogen
What is recombinant DNA technology
Recombinant DNA technology involves the transfer of fragments of DNA from one organism, or species, to another
Why can DNA fragments be transferred
The genetic code is universal,
so the transferred DNA will be translated in the cells of the recipient organism
What does transgenic mean
An organism that has had DNA transferred to it is called transgenic
How can fragments of DNA be produced
Using reverse transcriptase to convert mRNA to cDNA
Using restriction enzymes to cut a fragment containing the gene from the DNA
Using a ‘gene machine’ to create the desired section of DNA
How can DNA fragments be amplified
Fragments of DNA can be amplified by vitro and in vivo techniques.
Describe in vitro techniques
In vitro refers to techniques that involve a lab
What is PCR
The polymerase chain reaction (PCR) is an example of an in vitro method
PCR makes millions of copies of a DNA fragment in a few hours
What are the four things required for PCR
A reaction mixture containing the DNA sample, free nucleotides, DNA polymerase, and DNA primers (short pieces of DNA that are complementary to the ends of the DNA strand) is set up
Describe the procedure for PCR
1.The mixture is heated to 90C to break the hydrogen bonds between the complementary strands of DNA
2.The mixture is then cooled to between 50 and 65C so that primers can (bind) to the strands
3.The mixture is heated again to 72C for the DNA polymerase joins nucleotide
4.In every cycle of PCR, the volume of DNA doubles
How can the plasmid taken up by bacteria be identified
Marker genes’ can be inserted into the plasmid as well so that bacteria that have taken up the plasmid can be identified
Describe in vivo method as an example of recombinant technology
1.The required DNA fragment is isolated using restriction endonucleases, reverse transcriptase, or a gene machine.
2.The DNA is cut to form ‘sticky ends’ that allow it to join to other DNA strands
3.plasmid is cut open using restriction endonuclease
4The DNA is inserted into a loop of plasmid DNA that acts as a vector.
5.Ligases are used that act as ‘glue’ to join the DNA to the strands by forming complementary sticky ends
6.This recombinant plasmid is transferred to a bacterium and the transformed bacteria are identified and isolated.
- the bacteria are allowed to grow and divide and the protein produced from the recombinant plasmid is isolated
Describe how enzymes could be used to insert genes in a plasmid
Restriction endonucleases to cut plasmid
Ligase joins genes
What are promoter and terminator regions
Regions of the DNA that start or stop transcription
How can recombinant DNA technology be beneficial to humans
- Crops can be transformed to give higher yield or be more nutritious
- industrial enzymes can be formed
-medicines and vaccines can be made cheaply using recombinant DNA technology
-gene therapy
What are DNA probes
Short single strand of DNA
Base complementary with DNA
Why is it important to locate specific alleles
- can be used to see if a person has an allele that could lead to them having a genetic disorder
Describe the structure of a DNA probe
Short strands of DNA that have complementary base sequences to target allele
Attached to fluorescent or radioactive label meaning they can be seen under UV light
What is DNA microarray
A glass slide with DNA probes attached to it
When Using microarray ,the DNA probes are not labelled ,the human DNA added is
Human DNA binds to any of the DNA probes that are complementary
When the tray is rinsed and looked at under UV light ,only certain spots on the microarray will light up. This indicates which alleles are present.
What is variable number tandem repeats
Some of the non-coding DNA of an organism is made up of Variable Number Tandem Repeats (VNTRs)
They are long chains of repeating base sequences eg ATGCATGCATGCATGCATGC…
What is gel electrophoresis
Gel electrophoresis is used to separate DNA fragments to make a genetic fingerprint
What is genetic fingerprinting
Variable Number Tandem Repeats (VNTRs)
They are long chains of repeating base sequences eg ATGCATGCATGCATGCATGC…
The number of repeats varies between individuals and can be compared
This is genetic fingerprinting
Outline gel electrophoresis
1.A DNA sample is obtained and the areas containing VNTRs are amplified using PCR
2.DNA fragments corresponding to the length of the VNTRs are obtained and a fluorescent tag is added
3.The DNA mixture is placed in a slab of gel and is covered with a buffer solution that conducts electricity
4.An electrical current is passed through the gel
5. DNA is negatively charged so the fragments move towards the positive electrode
6.Smaller, more charged DNA fragments move further than heavier, less charged ones
7. The electrical current is turned off and the DNA is transferred to a thin nylon membrane in a process known as Southern Blotting
8. Under UV light, bands of DNA can be seen which is the individual’s genetic fingerprint
9. Two genetic fingerprints can be compared and if both fingerprints have a band on the same location on the gel, it means they have the same number of VNTRs and are therefore related
What are DNA primers
(short pieces of DNA that are complementary to the ends of the DNA strand)
Explain how increased methylation leads to cancer
Methyl groups added to a tumour suppressor
The transcription of tumour suppressor gene is inhibited
Leading to uncontrolled cell division
Outline DNA hybridisation
1.A sample of DNA is digested into fragments using restriction enzymes and separated through a process known as electrophoresis
- The separated DNA fragments are then transferred to a thin nylon membrane and the fluorescently - labelled DNA probe is added
- If the allele is present, the DNA probe will bind to it
4.The membrane is then exposed to UV light and if the allele is present, a fluorescent band will appear
Describe the uses of DNA probes
Used in DNA microarrays
Used to screen for inherited conditions
