bio retake

Question 1

How many spaces would there be if TATTCCGGTATTCACGGCTAATACCGGTTATTCAGCG was cut?

Answer 1

4

Question 2

What biological sample does not contain DNA?

Answer 2

Fingerprints

Question 3

What kind of group is not a part of a nucleotide?

Answer 3

Carboxyl group

Question 4

If the sequence of a DNA strand is ATCGTTACGAAA, what would it’s complimentary be?

Answer 4

TAGCAATGCTTT

Question 5

Organize chromosome, genome, nucleotide, and gene from least to most genetic form:

Answer 5

Genome, chromosome, gene, nucleotide

Question 6

What would be the first step in a crime scene investigation?

Answer 6

Secure the scene

Question 7

When running a gel electrophoresis, DNA will migrate towards the ___________ end because DNA has a ____________ charge

Answer 7

Positive; negative

Question 8

What is the backbone (strand) of DNA composed of?

Answer 8

Phosphates and sugars

Question 9

According to Chargaff’s Rule, if you have 28% thymine bases, you’d have how many (percent wise) guanine bases?

Answer 9

22%

Question 10

DNA is cut at specific sequences by using what?

Answer 10

Restriction enzymes

Question 11

Scientists are able to cut DNA at specific sequences into multiple segments known as what?

Answer 11

RFLP’s

Question 12

What is not a way that blood can be analyzed (at a crime scene)?

Answer 12

The color of blood can indicate venous or arterial

Question 13

In a gel electrophoresis, the smaller the DNA fragment…

Answer 13

…the farther it moves down the gel

Question 14

A molecule composed of nucleotides is what?

Answer 14

Nucleic acids

Question 15

If blood droplets fall from directly above, it will leave a __________ stain:

Answer 15

Circular