Unit 5 Study Guide Flashcards
What does DNA stands for?
Deoxyribose Nucleic Acid
What does DNA stands for?
Deoxyribose Nucleic Acid
In DNA, the base pair adenine pairs up with what other base?
Thymine
In transcription the base pair thymine pairs up with what base?
Adnine
RNA is a single/double strand nucleic acid.
Single
What characteristics did Watson and Crick both agreed that a DNA molecule had to have?
Store information. Copy with precision. Make mistakes. Be able to be read. Large, long, and thin. Consisted of three parts. Sugar, phosphate, a nitrogenous base. It was a helix.
Who were the first to “discover” the structure of DNA?
Watson and Crick
The purines in DNA and RNA include which bases?
Adenine and Guanine
The term for the exchange of information from DNA to mRNA is called what?
Transcription
What does mRNA stands for?
Messenger RNA
mRNA moves from the ribosome to the nucleus in order to produce more what?
False. It moves from the nucleus TO the ribosome to produce protein.
Protein production takes place in the cytoplasm at which organelle?
Ribosome
After transcription the mRNA moves out of the nucleus and into the cytoplasm traveling to what organelle?
Ribosome
The backbone or upright portion of DNA is alternating ___ and ___.
Phosphate Sugar
When DNA is replicated it unzips and then each base pair is matched with its corresponding base resulting in two identical molecules of what?
DNA
In DNA the base guanine pairs up the with what base?
Cytosine
Translation takes place where?
Ribosome in the cytoplasm
In RNA, during transcription, the base pair adenine pairs up with which base?
Uracil
tRNA stands for what?
Transfer RNA
In DNA, the base pair cytosine pairs up with which base?
Guanine
In DNA, the base pair thymine pairs up with which base?
Adenine
Protein is actually a string of what?
Amino acids
Every three base pairs in RNA is called a?
Codon
What does DNA do?
Codes for the amino acid sequence in proteins.
The physical structure of the genetic code is DNA’s sequence of what?
Base pairs or bases
The general shape of a DNA molecule is what?
Double helix
How would you describe RNA?
Single strand with ribose sugar and uracil instead of thymine.
The pattern of base pairing in DNA can be summarized by what rule?
Purines with two hydrogen bonds can only bond with pyrimidines with two hydrogen bonds, and purines with three hydrogen bonds can only pair with pyrimidines with three hydrogen bonds.
Transporting amino acids to the ribosomes for assembly into needed proteins is the function of what?
tRNA
Transcription occurs where?
Nucleus
The number of bases in a codon is?
Three
If you were given the base sequence: ACGUCGUCGUAUUAGUCCGAUG, you would have which nucleic acid?
RNA
Uracil is a purine/pyrimidine?
Pyrimidine
How many rings do pyrimidine have?
One
What is the correct order for protein synthesis?
DNA, transcription, mRNA, ribosome, translation, tRNA, protein.
How many types of RNA are there?
Three mRNA tRNA rRNA
What were Watson and Crick were looking for in a DNA molecule?
Store information. Copy with precision. Make mistakes. Be able to be read. Large, long, and thin. Consisted of three parts. Sugar, phosphate, a nitrogenous base. It was a helix.
A sugar, phosphate, and a nitrogenous base make up what molecule?
Nucelotide
Which of the letters points to sugar?
F
Which of the letters points to adenine?
B
Which of the letters points to the nitrogenous base that is paired with cytosine?
C
Which letter points to a phosphate?
D
Which letter points to the nitrogenous base that is replaced with uracil in mRNA?
E
A helix can best be described as what shape?
A spiral.
RNA stand for what?
Ribose Nucleic Acid
How many different types of amino acids are there?
20
How many different codons are there?
64
What does the following table show?
The ratio between adenine and thymine is 1:1 and the ratio between guanine and cytosine is 1:1.
Do you know how to read a amino acid translation table like the one in your study guide?
Yes?
No?
What is the purine that pairs with thymine?
Adenine
What is the term for a sugar, phosphate, and a nitrogenous base?
Nucleotide
The base that replaces thymine in mRNA.
Uracil
What would you call two parallel spirals?
Double helix
What is the name of the nucleic acid tha brings amino acids to the ribosome?
tRNA
What is the name of the nucleic acid that is copied from DNA and moves to the ribosome?
mRNA
What is the term for the copying of DNA to mRNA?
Transcription
What is the term for three base pairs that code for an amino acid?
Codon
Explain the principle function of DNA in cells.
DNA codes for proteins. The sequence of three bases is a codon that codes for an amino acid. The sequence is read at the ribosome and the correct amino acid is brought and assembled onto the growing protein by tRNA.
Describe the basic structure of a DNA molecule.
DNA is composed of monomers made of one sugar, a phosphate, and a nitrogenous base (adenine, guanin, cytosine, or thymine). In it’s final molecule, it forms a double hellix where the “backbone” is made of the sugar and phosphate and the “rungs” are composed of the nitrogenous bases.
Summarize the process of replication.
DNA is unzipped by an enzyme and each base is matched with it’s corresponding base. Adenine with thymine, cytosine with guanine, thymine with adenine, and guanine with cytosine. The result is two identical strands of DNA.
List four things Watson and Crick kenw about DNA and describe why they are important.
- Store information. The DNA stores the information on how to make the organism, each organ, each cell, and all of the proteins in each individual.
- Be able to be copied. Each individual starts as one cell and grows to more than 50 trillion cells, each with the identical DNA.
- Be able to make mistakes. Needed to explain cancer, evolution, and genetic defects.
- Be able to be read. The cell has to be able to get the information out of the DNA to make the correct proteins.
Compare and contrast DNA and RNA.
Both are nucleic acids composed of a sugar, phosphate, and nitrogenous bases.
Both store information on how to make proteins.
DNA’s sugar is deoxyribose, RNA’s sugar is ribose.
DNA is a double strand or helix, RNA is a single strand.
DNA has thymine, but no uracil. RNA has uracil, but no thymine.
Summarize the process of transcription.
DNA is transcribed into mRNA in the nucleus. Transcription pairs adenine with thymine, guanine with cytosine, cytosine with guanine, and uracil with adenine.
Describe the function and structure of a codon.
The function is to code for an amino acid and the structure is three bases.
Summarize the process of translation.
At the ribosome, the mRNA is translated into the correct sequence of amino acids. Each sequence of three bases, the codon, is read and the correct amino acid is brought to the ribosome by tRNA.
Give a brief description of protein synthesis.
DNA is transcribed into mRNA in the nucleus. Transcription pairs adenine with thymine, guanine with cytosine, cytosine with guanine, and uracil with adenine. mRNA moves out of the nucleus and into the cytoplasm to the ribosome. At the ribosome, the mRNA is translated into the correct sequence of amino acids. Each sequence of three bases, the codon, is read and the correct amino acid is brought to the ribosome by tRNA.
