Translation Flashcards
Open reading frames (OFR)
5’AUGGACAAUGGACUUUUGAAGUACAUACCCGGCAACUACUAUGACUAUUCC 3’ =mRNA
degenerate= codons can code for more than one amino acid
be careful with open reading frame as when you start translating into amino acids it might not start at the beginning of the sequences
there may be a case where there are two reading frames so you will get different amino acids
ORFs create different proteins normally only 3 different ones
When translating gDNA
a fragment of DNA is double stranded do you get get 3 different proteins per strand therefore you now have 6
*=stop codons
blast x could translate it for different frames
if there is a start codon that is the beginning of the reading frame.
Genetic code
there is also human mitochondrial genetic code
so there are different genetic codes that exists.
cyt b is mitochondrial gene
stop codon may code for something else in a different genetic code
What do we need for Translation?
Translation needs three different RNAs:
* mRNA
* tRNA
* rRNA
tRNA
clover leaf
it is charged so it can bind to the amino acid.
tRNA synthetase
rRNA
ribosomes are made of 2 subunits
one is made of proteins the other is made of rRNA
ribosomes in eukarya=80s
ribosomes in bacteria =70s
s values is rate of sedimentation in a centrifuge (can’t add them)
various types of rRNA
Some of these sequences are
well conserved and are used to
infer phylogenetic relationships.
rRNA can be modified
What is the direction of translation
Read and synthesized from 5’ to3’
proteins start with N-terminal (amine end) then towards the C-terminal (the carboxyl group)
Describe the structure of a ribososme
ribosomes are not membrane-enclosed organelles
A ribosome is a cellular structure responsible for protein synthesis. It consists of two subunits (large and small) made up of ribosomal RNA (rRNA) and proteins. The large subunit has the peptidyl transferase center (PTC) for peptide bond formation. The small subunit binds to mRNA. There are three tRNA-binding sites (A, P, E) for amino acid transfer. Ribosomes undergo conformational changes during translation. The exit tunnel allows the emerging polypeptide chain to exit. The structure is conserved across prokaryotes and eukaryotes.
(A,P,E)
Exit-site
Peptidyl-tRNA-site
Aminoacyl-tRNA-site
Describe the process of translation
Initiation:
The small ribosomal subunit binds to the mRNA at the start codon (AUG) with the help of initiation factors.
The initiator tRNA, carrying the amino acid methionine, binds to the start codon in the P site of the ribosome.
Elongation:
Aminoacyl-tRNA molecules carrying specific amino acids enter the A site of the ribosome, guided by codon-anticodon interactions.
The ribosome catalyzes the formation of a peptide bond between the amino acid on the tRNA in the A site and the growing polypeptide chain on the tRNA in the P site. This process occurs in the peptidyl transferase center (PTC) of the large ribosomal subunit.
The ribosome then translocates along the mRNA, shifting the tRNAs from A and P sites to P and E sites, respectively.
The uncharged tRNA exits the ribosome from the E site.
Termination:
Elongation continues until a stop codon (UAA, UAG, or UGA) is reached on the mRNA.
Release factors bind to the stop codon in the A site, causing the release of the polypeptide chain from the tRNA in the P site.
The ribosomal subunits and other components dissociate from the mRNA, completing the translation process.
Post-Translation Processing:
The newly synthesized polypeptide chain may undergo post-translational modifications, such as folding, cleavage, or addition of functional groups, to become a functional protein.
Chaperone proteins may assist in proper folding.
Protein Folding and Targeting:
The protein folds into its three-dimensional structure, determined by its amino acid sequence.
If the protein is destined for a specific cellular compartment or organelle, it may undergo additional targeting and transport processes.
Final Protein Product:
The fully processed and folded protein becomes functional and carries out its specific biological roles within the cell.
What aids translation (accessory molecules)
Describe elongation factors ( no need to memorise names)
there are accessory molecules that help the process of translation
with bacterial (EF-Tu and EF-G) or eukaryotic (EF-1
and EF-2) elongation factor
GTP carries energy for breaking bond from tRNA and then forming bond between amino acids.
release of a phosphate which changes conformation of ribosomes to form new bond
translation of mRNA can be translated by different ribosomes at the same time producing many copies from the protein.
Inhibitors of translation
understand that inhibitors act on different processes. e.g when choosing the right antibiotic
e.g Streptomycin on bacterial cells. Prevents the transition from initiation complex to chain-elongating ribosome and also causes miscoding
Initiation of translation in bacterial cells
- Polycistronic mRNAs (multiple ORFs)=mRNA molecule that can encode multiple proteins in prokaryotic cells, such as bacteria and archaea. In a polycistronic mRNA, multiple open reading frames (ORFs) exist, each encoding a distinct protein. Good for when multiple proteins needed at the same time.
- In bacteria Transcription and translation can be coupled (space and time)
In eukaryotic cells they are not coupled as they occur in different places. - Start of translation often is close to Shine-Dalgarno sequence (few bases before start of translation, a signal for where ribosomes binds)
- Shine-Dalgarno (consensus 5′-AGGAGGU-3′): purine-rich
initiation sequence, binds to complementary pyrimidine-rich
sequence on the 3’ end of the 16S rRNA in small ribosomal
subunit. Usually 6-8 nucleotides before the initiating AUG.
Initiation of translation in eukaryotic cells
NO Shine-Dalgarno sequence in eukaryotic cells
- Monocistronic mRNAs
- Transcription and translation are separate in space and time
- The small ribosomal subunit interacts with eIFs, recognition
and recruitment to 5’ cap → the complex 40S-eIFs scans the
mRNA to the initiating AUG (no Shine-Dalgarno sequence) →
release of eIFs → binding of the large subunit (60S) → elongation of the polypeptide chain
Protein folding and quality control
growing polypeptide chain
folded N-terminal domain
folding C-terminal domain
folding
What happens if there is protein misfolding?
If this happen it will be fixed or hydrolysed as it would be a wait of material but they can also be dangerous for the cell.
proteosome (cylinder) where misfolded protein is taken into,
how does the cell know? By the addition of the flag ubiquitin is a flag put on proteins that need to be eliminated. Proteosome breaks down proteins, ubiquitin is recycled and used to label other things
