Topic A:Molecular biology, biochemistry, cell biology

Question 1

(2014) Cdc25 was identified in Lee Hartwell’s screen for cell division cycle mutants in budding yeast. Assuming the mutation ihibits the function of the protein, what effect would you expect it to have on cell cycle progression? Explain your reasoning

Answer 1

The wee1 kinase inhibits cyclin which regulates progression of the cell cycle. Cdc25 phosphotase reverses wee1 inhibition and allows cell cycle progression. Thereby a mutation in cdc25 could result in an arrest of the cell cycle.

Question 2

(2014) If a diploid cell in G1 phase of the cell cycle contains 4 picograms (4 x 10−15 grams) of DNA, how much DNA would you expect to find in a gamete?

Answer 2

2 x 10−15 grams DNA

Question 3

Consider a G-protein linked receptor in a signaling pathway that leads to the activation of adenylyl cyclase. What happens to cAMP levels in the cell after ligand binding to the receptor?

Answer 3

cAMP levles increase and cAMP is synthesized from ATP by adenylyl cyclase

Question 4

Leptin is a circulating hormone important for the regulation of body weight. This protein is synthesized and secreted by adipose (fat) cells. Although many cells are exposed to leptin, only a subset of cells seem to respond to the hormone. What is the simplest explanation for why some cells respond to this hormone and others do not?

Answer 4

some cells have receptors that bind the hormone allowing it ot respond to the signal whereas other cells do not have receptors for this hormone and thus the hormone has no effect

Question 5

The first human oncogene identified encodes a mutant form of the Ras protein in which the 12th amino acid is glycine instead of valine. This mutation decreases the GTPase activity of Ras. When the cell expressing the mutant Ras protein is exposed to EFG, what will happen to the MAP kinase activi

Answer 5

n MAPk/ERK pathway, ligand EGF binds to EGF receptor that activates the receptor to phos- phorylate itself, the phosphorylated receptor binds to the adaptor protein, which couples the signal downstream and activates the MAP kinase. MAPK then attaches phosphates to target proteins like Myc transcription factor and alters gene transcription and cell cycle preoduction. In the cell with mutatnt Ras, MAPK activity will increase, decreasing GTPase activity of Ras.

Question 6

What type of cell-cell signalling involves direct interactions between cells? Name one class of proteins required for this type of signalling.

Answer 6

juxtacrine signaling; extracellular matrix proteins are required

Question 7

A) Which of the following mutations would you expect might be associated with cancer? Briefly explain your reasoning.

a. A mutation that causes Ras to hydrolyze GTP less efficiently
b. A mutation that casues Ras to hydrolyze GTP more efficiently
c. A mutation that prevents Ras from binding GTP

Answer 7

a

Question 8

Mutations in the Ras GTPase protein.Do you expect this mutation would be dominant or recessive? Briefly explain your reasoning.

Answer 8

dominant because loss of function is leading to uncontrolled prolifera

Question 9

A Ras mutation that occurs spontaneously in an epithelial cell in the colon would increase the risk of colon cancer. Would this increased risk be inherited? Why or why not?

Answer 9

No, only a germline mutation is inherited

Question 10

Which of the following proteins couple a chemical cycle of ATP binding, hydrolysis, and release to a mechanical cycle?

a. Adenylyl cyclase
b. cAMP-dependent protein kinase (PKA)
c. Dynein
d. Ras GTPase
e. a potassium channel
f. kinesin
g. MAP kinase

Answer 10

a. catalyse the conversion of adenosine triphosphate (ATP) to 3’,5’-cyclic AMP (cAMP) and pyrophosphate?

Question 11

In which of the following polymers are the monomers connected by non-covalent bonds?

a. DNA
b. RNA
c. Proteins
d. Microtubules

Answer 11

d

Question 12

Protein kinases typically remove phosphates from:

a. adenosine
b. serine
c. threonine
d. tyrosine
e. none of the above

Answer 12

e

Question 13

Describe the core splicing sequencing elements that are required for the splicing of a mammalian intron.

Answer 13

5’ splice consensus - (AC)AG/GT(AG)AGT

3’ splice site consensus-YYYYYYYYYYNCAG/G Branchpoint consensus- YNCURAC

Question 14

What is the predominant RNA polymerase that generates mammalian miRNAs? What se- quence features do miRNAs and mRNAs share?

Answer 14

RNA pol II generates mammalian miRNAs

hairpin, stem loops, 3’ poly A tail and 5’ cap, 5’ splice consensus sequence

Question 15

Describe the main RNA cleavage steps in the nucleus and cytoplasm that are involved in the processing of mammalian microRNAs and at least one protein component involved in each cleavage step.

Answer 15

A gene is transcribed into pri-miRNA in the nucleus. Drosha and Pasha cleave the 5’ cap and 3’ poly-A tail . The resulting product is pre-miRNA. Ran-GTP, Exportin-5 exports pre-miRNA into the cytosol. Dicer cleaves the hairpin loop, and an miRNA/miRNA* duplex is formed.Argo recognizes the miRNA and form the miRNP silencing complex(RISC).

Question 16

Describe one epigenetic modification that is associated with active gene transcription and one that is associated with repression of transcription.

Answer 16

histone methylation is typically associated with repression and histone acetylation is associated with activation

Question 17

Provide 4 examples of histone modifications that can influence gene expression.

Answer 17

H3K27me1 - mono-methylation = activation
H3K27ac - acetylation = activation
H3K27me2 - di-methylation = repression
H3K27me3 - tri-methylation = repression
H3K4me3 - tri-methylation = activation
H3K4me1 - mono-methylation = activation
H3K9me1 - mono-methylation = activation 
H3K9me2 - di-methlaytion = repression
H3K9me2 - tri-methylation = repression
H3K9ac - acetylation = activation 
H3K14ac - acetylation = activation
H3K36me3- activation

Question 18

Describe the difference between a eukaryotic gene promoter and enhancer.

Answer 18

Both are needed for transcription. A promoter is near the gene (at TSS), and general TF involved in pre-intiation complex bind to the promoter. An enhancer is upstream of the gene(up to kb away) and specific TF bind here. Enhancers can interact w/ promoter by bringing sites into direct contact via loop-like structure.

Question 19

Give two examples of genome-wide approaches that can be carried out to identify regions of active transcription in a eukaryotic cell

Answer 19

1. Nuclear run on experiments like GRO-seq (GRO=genomic run on) -isolate cell nuclei, label with nucleotides -genes in the process of transcription are detected by hybridization of extracted RNA to gene specific probes on a blot -GRO allows for calculation of transcription rates
2. DNase I hypersensitive sites sequencing (DNase seq)– cuts open chromatin, if it cuts, you see a peak, indicating active transcription
3. ChIP-Seq for acetylated/active histone markers

Question 20

How do the mechanisms of translation initiation differ between prokaryotes and eukaryotes?

Answer 20

Shine-Delgarno sequence in prokaryotes helps recruit the ribosome to the mRNA to initiate protein synthesis by aligning it with the start codon In eukaryotes, initiation of translation usually involves the interaction of certain key proteins with a special tag bound to the 5’-end of an mRNA molecule, the 5’ cap, as well as with the 5’ UTR (Kozak sequence which occurs on eukaryotic mRNA and has the consensus (gcc)gccRccAUGG)

Question 21

What is the typical nucleosome positioning in the promoter of a housekeeping gene

Answer 21

This canonical promoter chromatin structure = ( 1 nucleosome/Nucleosome Free Region/+ 1 nucleosome) .NFR width correlates somewhat with transcription levels in yeast.

Question 22

Name two similarities and two differences between histone methylation and acetylation

Answer 22

Similarities: 1) both modify lysine 2) both are associated with activation 3) act on histone tails

Differences: 1) gene regulation (acetylation–activation; methylation–mostly repression) 2) can add 1,2,or 3 methyl groups to lysine, but only one acetyl group 3) arginine can by methylated (only 1 or 2 times) but not acetylated 4) electrical charge: methylation is neutral, acetylation is negatively charged

Question 23

For each question provide a molecular/cellular explanation for the described phenomena?
A loss-of-function mutation that has a dominant phenotype.

Answer 23

If the remaining wild-type allele cannot compensate for the loss-of-function in the mutated allele, then the dominant phenotype will be the loss-of-function mutant (haploinsufficiency)

Question 24

Explain why A null mutation that has no obvious phenotype.

Answer 24

If heterozygous, the null mutant is compensated for by the wild-type allele. If homozygous, there may be redundant pathway or a second copy of the gene may exist elsewhere.

Question 25

Explain why Recessive, non-allelic mutations that have exactly the same phenotype.

Answer 25

Allelic- in same gene; Non-allelic- in different genes (use complementation testing to confirm) Both may be critical parts of the same pathway

Question 26

Explain why X-ray-induced mutations are often lethal in the homozygous condition.

Answer 26

X-ray induced mutations often cause deletions due to the creation of double-stranded breaks in the chromosome. If the deletion cannot be rescued by a wild type, it may be lethal if the gene is essential for viability.

Question 27

Explain why a mutation whose homozygous phenotype (m/m) is less severe than its phenotype in trans to a deletion (m/deletion).

Answer 27

A hypomorphic mutation would cause a reduced level of activity, so more of the gene would make the phenotype closer to wild-type than the mutant in trans to a deletion.

Question 28

Explain why Two recessive mutations with the same phenotype (e.g. small wings) are crossed to each other, and the resulting F1 progeny have a wild-type phenotype.

Answer 28

The mutations are non-allelic: they occur on different genes

Question 29

Recombination map distance (cM) corresponds to a larger physical distance (i.e. amount of DNA) near the centromere than near the end of a chromosome.

Answer 29

Recombination frequency decreases the closer alleles are to the centromere. There is less recombination near the centromere so near the ends of the chromosome, where there is more recombination, you can map at a greater resolution (smaller cM distances)

Question 30

Dominant negative alleles sometimes have a more severe phenotype than null alleles of the same gene

Answer 30

If the mutation is an antimorphic mutation, then it may be actively antagonistic to wild-type and therefore more severe than a null mutant.

Question 31

If the RNAi phenotype for a gene is different from the phenotype caused by an actual mutation in that gene, what are some possible explanations? Suggest at least three different possibilities in detail.

Answer 31

1. RNAi knocked-down the gene but didnt knock it out
2. The real mutation is not a loss-of-function mutation (which is what RNAi is simulating)
3. If mutation is in gene involved in development.(Gene may be expressed early on, but knocking it down with RNAi later in the developmental process will have no effect later on

Question 32

You are working in a mouse model of a human disease that is caused by overexpression of a specific gene, and want to develop an RNAi assay to lead to gene knockdown. Please describe the 21 nt dsRNA that you would design to bind to the following sequence in the target mRNA: 5’ CGTCATGGCCAGTACGCGTCA 3’ Label the guide and passenger strand, and describe how you would ensure that the proper smRNA strand winds up being bound by an AGO protein.

Answer 32

5’ CGUCAUGGCCAGUACGCGUCA 3’ passngr
3’ GCAGUACCGGUCAUGCGCAGU 5’

Passenger strand needs to be same as target mRNA, so that the guide strand is the complement to the sequence you are targeting. The guide strand is the one whose 5 end is less stably paired to its complement, which works out in this particular case, but you could also introduce a mismatch to the 3 end of the passenger strand (change A to C), so that the right guide strand is selected. The passenger strand is degraded and the guide strand is bound by AGO. Even with processing, will still have functional siRNAs (19mers).

Question 33

**You are interested in determining the mechanisms of target RNA silencing that can be directed by a specific mouse miRNA of interest. What experimental approach would you use to determine the mechanism of action used by this miRNA? Describe in detail how you set up this approach and what controls you would need.

Answer 33

miRNAs bind complementary to mRNA sequence and degrade them , resulting in reduce expression. If you use miRNA sponges (circular mRNA) to bind to these miRNA, then expression should be increase.

Question 34

You want to know if miRNA155 has an important regulatory role in Arabidopsis development. Describe an experiment that you would use for determining if miRNA155 is important for the devel-opment of this model plant.

Answer 34

Use a miRNA mimic (sponge) that will soak up all of your miRNA from the Arabidopsis plants at all developmental stages allowing you to assess if miRNA155 affects any developmental processes in these model plants

Question 35

In an experiment you are starting with a phenotype and then working to identify the underlying genetic basis. Describe a genetic screen you could use to do this? How would you use high-throughput sequencing to identify the underlying genetic basis of the phenotype once you have identified some mu-tants from your genetic screen? Please describe this high-throughput sequencing approach in detail, including all of the necessary genetic crosses to be done, etc.

Answer 35

Outline (Forward genetics):

1. Mutagenesis screen for mutant strains with the phenotype
2. Positional cloning (SNP mapping) using high-throughput sequencing approach

Question 36

You have been studying the mouse locus containing a non-coding RNA (Awd2n) that us located adjacent to a growth-promoting gene(CanD2) that is expressed at a normal level in wild type mice. Homozygous deletion of the Awd2n promoter in mice results in overexpression of CanD2 gene and the eventual appearance of tumors in the lungs. However, heterozygous transmission of a promoter mutation is baffling you. Maternal transmission of the promoter mutation causes CanD2 overexpression and the same tumorigenic phenotype observed with the homozygous deletion but paternal transmission appears wild type. Offer a detailed explanation for this result, including a sketch of the locus in question. Describe in detail an experiment in mice that will allow you to test your hypothesis.

Answer 36

Maternal effect, imprinting, x-linked

Question 37

Describe the core splicing sequence elements that are required for the splicing of a mammalian intron.

Answer 37

5’ splice consensus - (AC)AG/GT(AG)AGT

3’ splice site consensus-YYYYYYYYYYNCAG/G Branchpoint consensus- YNCURAC

Question 38

For the vast majority of spliced introns, describe the invariant nucleotides that are required for splicing and their location.

Answer 38

5 splice site consensus: AG|GT
BRANCH POINT: A
3 splice site consensus: AG|?

Question 39

Describe two additional sequences or structures that can promote the splicing reaction of a given pre-mRNA transcript

Answer 39

Splicing regulatory elements:ESE: Exonic splicing enhancers, ESS: silencers ISE/ISS: Intronic distance between nonsense sequences
Exon-definition: spliced efficiently

Question 40

What is the predominant RNA polymerase that generates mammalian miRNAs?

Answer 40

RNA polymerase II

Question 41

Describe the main RNA cleavage steps in the nucleus and cytoplasm that are involved in the process of mammalian microRNAs and at least one component of each cleavage step.

Answer 41

RNA Poll II transcript is synthesized in nucleus and folds back on itself. Drosha cleaves to form a short hairpin which is exported out of the nucleus where Dicer cleaves to form mature 18-22 nt miRNA which is loaded into aragonite protein.

Question 42

How are pre-miRNAs exported to the cytoplasm and how is that only cleaved pre-miRNAS are exported.

Answer 42

Exportin-5 recognizes a two-nucleotide overhand left by the RNAse III enzyme Drosha at the 3’ end of the pre-miRNA hairpin. Uses Ran GTP.

Question 43

Briefly describe at least two different methods to determine the secondary structure of RNA other than de novo computational folding.

Answer 43

1. Comparative sequence analysis: Molecules with similar functions and different nucleotide sequences will form similar structures.
2. Use RNA-seq to determine the RNA secondary structures (This is what Brian Gregory’s lab is doing)

Question 44

Name three genes in the biogenesis pathway and function of miRNAs

Answer 44

Drosha, Exportin-5, and Dicer

Question 45

In a typical experiment that uses siRNAs or shRNAs to selectively target a given gene transcript it is assumed that the phenotype is due to knockdown of the target. However, partial complementarity to other transcripts can also lead to the down regulation of other genes as well. Describe two methods that can be used to provide further evidence that the effect observed upon knockdown is specific.

Answer 45

Rescue wild type with cDNA copy of the gene
Rescue wild type with mRNA resistant to siRNA degradation by not containing the seed sequence in the 3 UTR
miRNA sponge?

Question 46

What is usually the consequence of a mutation that introduces a premature termination codon(PTC) within an internal exon of a human protein coding gene? That, is the primary effect of the station to cause the affected allele to produce a truncated protein or is there another effect of the mutation on the gene expression?

Answer 46

Nonsense mediated decay usually degrades mRNA rather than truncated proteins being produced.

Question 47

Describe how the position of the premature stop codon can determine what the primary effect of the mutation will be on expression from the mutated allele.

Answer 47

If the PTC is >50 bp from the end of the second to last exon, NMD will be triggered following splicing and transcription whereby the exon junction complex persists on the mRNA instead of being knocked off by the first round translating ribosome. If the PTC is

Question 48

Describe at least one common epigenetic modification each associated associated with active gene transcription and repression of txn

Answer 48

histone acetylation is associated with active gene transcription and methylated cytosine are associated with repression of transcription

Question 49

Provide at least 4 examples of histone modifications that can influence gene expression

Answer 49

H3K4me: gene activation
H3K9me3: gene repression
H3k27me3: repression
H3K3me3: gene silencing
 OR
methylation, acetylation ,ubiquitylation , sumoylation

Question 50

Briefly describe at least four different kinds of epigenetic medication and their characteristics

Answer 50

DNA methylation:
histone methylation:
histone acetylation:
histone variants:

Question 51

Briefly describe two possible ways to identify DNA methylation.

Answer 51

1. Bisulfite sequencing: Treatment of DNA with bisulfite converts C to U (T in the final sequencing reads), but leaves mentholated C unaffected. The treated DNA are then sequenced.
2. MeDIP-seq: isolate methylated DNA fragments via an antibody against 5-methylcytosine (5mC) and follow by sequencing
3. Methylation sensitive restriction enzymes: These restriction enzymes are not able to cleave methylated-cytosine resides, leaving methylated DNA intact. By comparing to control DNA with sequencing technology we can detect the methylation status.

Question 52

Briefly describe the purpose of DNAse I hypersensitivity sequencing

Answer 52

This is used to study open chromatin regions. These regions are regulatory regions or actively transcribed regions.

Question 53

Give examples of 2 kinds of experimental genome-wide analysis that can be carried out to identify global regions of active txn in a cell.

Answer 53

1. DNAse-seq: open chromatin = txn active

2. Chip-Seq for TFs and histone marks indicative of open chromatin

Question 54

Why is DNA more stable than RNA? (Structure)

Answer 54

RNA has an additional 2’ OH group on its ribose sugar and C-OH is more reactive than C-H bonds so DNA is more stable with regard to spontaneous cleavage.

Question 55

Describe the RNA breaking and joining reactions of RNA splicing.

Answer 55

Nucleophilic attack by the 2’OH of a specific branch-point nucleotide within the intron (defined during spliceosome assembly) on the first nucleotide of the intron at the 5’ splice site forming the lariat 3’OH of the released 5’ exon then performs a nucleophillic attack at the last nucleotide of the intron at the 3’ splice site thus joining the exon and releasing the intron lariat.

Question 56

Describe the process of mRNA maturation.

Answer 56

RNA editing, introns are spliced out, 5’end is capped and the 3’ end is poly adenylated.

Question 57

The B-form of DNA structure was originally described by Watson and Crick. What are two other conformations of DNA and what are their characteristics?

Answer 57

A-DNA: wider right handed double helix with major and minor grooves. slight increase in the number of base pairs per rotation Z-DNA: left-handed double helix that occurs in segments of methylated DNA
B-form is right handed.

Question 58

What effect would removing the poly A tail from an mRNA message have.

Answer 58

1. Cannot protect mRNA from degradation by exonuclease

2. RNA not exported from the nucleus

Question 59

What is a miRNA and what are miRNA known to regulate?

Answer 59

miRNA are microRNAs which are small RNA molecules ~22 nucleotides in length. It is known to regulate target mRNAs with complementary base pairing sequence by its seed region (~7 nt). It usually results in translational repression and degradation of the mRNA transcript.

Question 60

What is the siRNA pathway commonly used for in current gene function studies?

Answer 60

Knock-down target gene expression.

Question 61

Name 2 criteria commonly used by algorithms for miRNA-target interactions.

Answer 61

1. Minimize free energy for stable duplex formation
2. Base-pair complementarity across a “seed” region
3. Conservation of the “seed” region and its target mRNA 3’UTR

Question 62

Describe three mechanisms by which DNA can move between bacterial cells.

Answer 62

Transduction: DNA is transferred from one bacterium to another by a virus through homologous recombination
Conjugation: transfers plasmids between cells, sometimes even transfer whole chr w. embedded plasmid
Transformation: DNA is taken up by bacteria on occasion new DNA is incorporated into the host genome and expressed

Question 63

Briefly describe the two axes of a Ramachandran Plot.

Answer 63

backbone dihedral angles psi against phi of amino acids in protein structures

useful to visualize protein structure and position of amino acids

Question 64

The signal peptide of secreted proteins in typically found on the (amino-terminus, carboxy-terminus, anywhere) of the protein while the nuclear localization signals is typically found on the (amino-terminus,carboy-terminus, anywhere) of the protein. Choose appropriate word.

Answer 64

secreted signal: amino-terminus

nuclear localization signal: anywhere

Question 65

Which of the following are likely to require a kinesin motor? (i) Movement of secretory vesicles towards the cell periphery (ii) Movement of endocytic vesicles towards the cell center. (iii) Microtubule polymerization and depolymersization. (iv) Movement of cargos along actin filaments.

Answer 65

(i) Movement of secretory vesicles towards the cell periphery Kinesin: a plus end directed microtubule motor, transport vesicles outward. It also involves micro-tubule depolymerization. Dynein: a minus end directed microtubule motor, can step backward to avoid obstacles in its path, transport vesicles inward.

Question 66

Rank the following amino acids in order of their hydrophobicity: A, G, I, R, and S.

Answer 66

Larger non-polar amino acids are more hydrophobic If there is an OH it will be more hydrophyllic In increasing order: R, S, G, A, I

Question 67

How many amino acids are involved in a peptide bond? What are the chemical groups that interact in a peptide bond?

Answer 67

Two amino acids in a single peptide bond
Carboxyl group and amino group interact in a peptide bond causing the release of water (dehydration synthesis reaction). Peptide bonds can be broken down by hydrolysis (addition of water)

Question 68

What are the two most common forms of protein secondary structure

Answer 68

alpha helix and beta sheet

Question 69

What type of protein structure involves interactions between different polypeptide chains? Name one type of covalent bond that is involved in this type of structure

Answer 69

quaternary proteins structures

disulfide bonds (coupling of two thiol groups)

Question 70

What type of enzyme transfers the terminal phosphate group of ATP to a specific amino acid of a target protein? Name two specific classes of these enzymes.

Answer 70

Kinases transfer terminal phosphate group of ATP to a specific AA of a target protein. There are Tyrosine Kinases, serine/threonine kinases.

Question 71

State the thermodynamic definition (with the appropriate equation) of the stability of a protein. Describe concisely how the stability may be measured using chemical denaturants such as urea (draw appropriate data plot if necessary).

Answer 71

delta G = delta H - T delta S

Question 72

Rank the following molecular structures in order of increasing length (longest linear di-mension): 8-residue β-strand, 12-residue α-helix, isoleucine, typical collagen triple helix, cytochrome c, valine.

Answer 72

valine, isoleucine, 12-residue alpha helix, 8-residue beta strand, cytochrom c, collagen triple helix
???

Question 73

Describe the hydrogen bonding pattern and residue periodicity of α-helix protein sec-ondary structure. Using a ‘helical wheel’ diagram if necessary, explain the concept of amphipathic helices. How this promotes specific assembly of helices into tertiary structure and what is the sequence signature of such a helix forming region?

Answer 73

Every backbone N-H group donates a hydrogen bond to the backbone C=O group of the amino acid four residues earlier.
Hydrophilic and hydrophobic sides, hydrophobic sides of various alpha helices aggregate together away from water while hydrophobic are on the surface. Methionine, alanine, leucine, glutamate, and lysine (MALEK) promote helix, proline and glycine disrupt helices.

Question 74

There are 20 naturally occurring amino acids used in proteins. Three of these are structurally unique. Name them and diagram their side chain structures. Describe how they are structurally special in the context of forming and maintaining the 3-D structure of a protein.

Answer 74

proline – good for bending glycine – small, good for packing cystine – good for stability (forms disulfide bonds)

Question 75

Explain how proteins are targeted for degradation.

Answer 75

Marked by ubiquitination and sent to proteosome for degredation

Question 76

Name 5 protein post-translational modifications.

Answer 76

ubiquitination, methylation, cleavage, acetylation, oxidation, phosphorylation, lipid addition

Question 77

Name at least three weak (noncovalent)interactions that determine the conformation of a pro-tein.

Answer 77

Ionic attraction, hydrogen bond, Van der waals, hydrophobic force

Question 78

Protein structure is determined by the amino acid sequence, and most proteins can fold spontaneously into their correct 3-D structure (at least in solution). Describe the experiment and the result that demonstrated this.

Answer 78

Experiment by Christian Anfinsen in early 1960’s using ribonuclease that they isolated from pan-creatic tissue of cattle. Ribonuclease can be denatured by adding certain chemicals or by heat. The disulphide bridges break and other forces of attraction between amino acids disappear, which makes the enzyme collapse into a tangled, useless ball. In various studies, Anfinsen showed that this denatu-ration process could be completely reversed by removing these denaturing chemicals or by lowering the temperature. The ribonuclease then folds back to its natural functional state on its own. So, Anfinsen concluded that the amino-acid sequence determines the shape of a protein. He ended up getting the Nobel Prize in Chem. in 1972.

Question 79

List the major interactions believed to be important in protein folding.

Answer 79

van der waals, hydrogen, cystine-disfulfide bonds, hydrophobic interactions

Question 80

You find that a protein of interest becomes more abundant as cells age.What technique would you use to demonstrate these results? Describe in detail how you perform this technique.Draw the experimental results that would allow you to make the conclusions written above. Make sure you label the drawing so that they correspond with the conclusions made for the experiment

Answer 80

Western blot. Do gel electrophoresis to separate out the protein, transfer the protein to a membrane and stain with a specific antibody for the target protein and use immunoglobin (or housekeeping protein) as a control. Do this for young cells and aged cells.
If your protein of interest becomes more abundant as the cell ages, the Western blots of the protein from older cells will stain darker than the Western blots from younger cells In this blot, lane 1 and 3 are the controls for both the young and old cells and lane 2 is protein from young cells and lane 4 is protein from older cells

Question 81

Very briefly describe the experiments needed to test the hypothesis ‘transcription factor CREB regulates the expression of gene HDAC6 by binding to a specified site relative to the gene’

Answer 81

ChIP-seq to find the specific binding site of CREB relative to HDAC6 followed by site specific mutagenesis of this site to see how this affects gene expression of HDAC6

Question 82

How would you find functional, direct targets of any given transcription factor?

Answer 82

ChIP-seq to find the direct targets of a transcription factor followed by site directed mutagenesis of those sites or a knock down of the transcription factor to see how that affects the expression of the targeted genes.

Question 83

Describe 3 different mechanisms of transcriptional regulation.

Answer 83

Enhancers, Insulators, LCRs, DNA methylation, histone modifications, etc.

Question 84

The role of genes that are altered in function or expression during tumorigenesis can be divided into at least three general classes. List 3 general roles and give an example of a gene from each class.

Answer 84

Gatekeepers: proliferation and apoptosis (p53)
Caretakers: prevent and repair damage to the genome (BRCA1)
Proto-oncogenes: increase the chance of progression to cancer when they are over-expressed (RAS)

Question 85

How would you subclone a cDNA into an expression vector?

Answer 85

Isolate RNA from cells, perform RTPCR to make cDNA , use gene specific primers to amplify the cDNA of your gene of interest, cut the ends of the cDNA using restriction enzymes, use the same enzymes to cut the ends of your vector, use ligase to glue the cDNA insert with the vector

Question 86

Briefly describe what is an expression vector including key features of the vector

Answer 86

Expression vector is usually a plasmid or virus designed for messenger RNA, and therefore proteins expression in cells. It must have elements necessary for protein expression: a strong promoter, the correct translation initiation sequence such as a ribosomal binding site and start codon, a strong termination codon, and a transcription termination sequence?.An expression vector has features that any vector may have, such as an origin of replication, a selectable marker, and a suitable site for the insertion of a gene such as the multiple cloning site.

Question 87

Briefly describe various stages and factors affecting the regulation of active proteins in a cell, starting with chromatinized DNA. Also indicate the technologies appropriate to detect the regulation at these various stages.

Answer 87

transcription: DNA methylation, histone modifications you can use ChIP-chip or ChIP-seq for histone modifications, Bisulfite sequencing for methylation, ATAC-seq

RNA processing control: alternative splicing, editing, and you can use exon-junction arrays, sequence transcripts and compare to genomic DNA to see if edited

translation: degradation of transcript, Nonsense mediated decay, localization of transcript before translation and you can use in situ RNA FISH for localization, block translation (cylcohexamide) and qPCR to look for NMD

PTM (degradation ,inactivation): use IP with antibody specific to PTM , Mass Spec, phosphate labeling

Question 88

What are the two general cellular processes that make the human proteome dramatically larger and more complex than the human genome? Starting with the total number of human genes, how much does each of these two processes increase the molecular complexity (order-of-magnitude) at the protein level and what is a realistic estimate of the total theoretical size of the human proteome? Considering that the human genome was successfully determined, why is it so difficult to determine and describe the total human proteome?.

Answer 88

Alternative splicing and Post Translation Modification Each of these increases roughly one order of magnitude Realistic estimate is 2million for the size of the human proteome It’s so difficult to determine the total human proteome because it’s different in each cell type, it is much larger, it’s dynamic, etc.

Question 89

The relationship between transcription and translation differs between prokaryotes and eukaryotes. Describe the differences, and one mechanism of gene regulation that differs as a result.

Answer 89

In prokaryotes transcription and translation occur in the same place and can also occur simultane-ously In eukaryotes transcription is in the nucleus and translation is in the cytoplasm The localization of transcripts occurs mainly in eukayotes – allows for location specific expression of a gene because it can be translated once it gets to the correct region of the cell The fact that transcription and translation occur at the same time in prokaryotes, there is not much post processing of the transcripts so the level of control occurs at transcription

Question 90

You are studying transcription of a bacterial promoter P. If you mix (in a suitable buffer) DNA containing this promoter with core RNA polymerase, you do not see any transcription. However if you also add a protein X then you are able to detect transcription. What is this protein an example of and what is its function?

Answer 90

This is a sigma factor and it functions to bind the promoter and bring the core RNApol to the site.

Question 91

Name 6 steps at which the activity of a gene can be regulated.

Answer 91

1. Transcriptional control
2. RNA processing control
3. RNA transport and localization control
4. Translational control
5. mRNA degradation control
6. protein activity control

Question 92

A typical pol II transcript contains a 5’ untranslated region (UTR), a coding region and a 3’ UTR. What are four of the roles of 5’ UTR and 3’ UTR.

Answer 92

In general:

1. mRNA stability
2. mRNA localization
3. translational efficiency
4. regulating the mRNA itself

5’ UTR:
1. ribosome binding site - Shine-Dalgarno sequence in prokaryotes
2. riboswitches element - binding site for proteins (ion response element, small target molecule)
3. mRNA export
3’ UTR:
1. polyadenylation signal
2. binding sites for miRNA
3. binding sites for protein (RNA stability, localization)

Question 93

Name four ways that a genes repertoire of encoded protein functions can be expanded.

Answer 93

1. Alternative splicing
2. RNA editing
3. Post translational modification
4. Protein-protein interactions

Question 94

What class of genes does Xist belong to and what is the general function of this gene.

Answer 94

It is a long non-coding RNA gene In early embryo female mammals cell, randomly express from one of the pair X chromosome and inac-tivate it’s own X chromosome by condensing the chromosome.

Question 95

What is the seed region of a miRNA and what is the likely functional consequence of a mutation in this region?

Answer 95

Seed region: The first few nucleotides (∼ 2-7 or 2-10) of a miRNA. It will not perfectly complementary binding its target gene, thus will not be functional to regulate its target genes. It could also have off-target effects and regulate other genes.

Question 96

What is the 3’ compensatory binding of miRNAs to their targets?

Answer 96

Pairing to the 3’ region of the miRNA can also compensate for a mismatch in the seed region. It is centered on miRNA nucleotides 13-17. The pairing can extend to nine consecutive Watson-Crick matches.

Question 97

Explain the difference between redundancy and active paralog compensation .

Answer 97

Redundancy: Two proteins/pathways have similar function, but they express/function independently. Active paralog compensation: Two proteins/pathways have similar function. While mutating/knocking out one of the proteins, the other protein will have higher expression behavior in order to compensate the lost of the mutated protein.

Question 98

Even though many scientists draw pathways as discrete entities, signal transduction pathways and networks in fact share components. What is the consequence of this integration?

Answer 98

Uncovering protein modules and gene regulating mechanisms that are supported by different types if interactions

Question 99

MicroRNAs (miRNas) are key regulators of gene expression. How do miRNA-target in-teractions differ in plant and metazoan (animal) cells? b) What is the consequence of this difference on the mechanism of gene regulation?

Answer 99

1) in animals: the targeting allow imprecise base-pairing, and can usually regulate through inhibitingtranslation. Often target 3’ end of the mRNA. in plants: usually require near perfect complementary binding, and induce mRNA degradation. Can also target coding region of the mRNA.
2) In animals, one miRNA can target multiple sites of the mRNA and a set of different miRNA. Less off-target in plants.

Question 100

Splicing is an important mechanism to generate diversity in protein structure and func-tion. You’ve discovered a specific splicing event in common with 20 genes that are regulated by hypoxia. Using informatics and experimental approaches, design experiments to identify candidate controlling elements.

Answer 100

Informatics: look for consensus sequences around splice sites Experimental: look for splice enhancers and repressors – deletion assays of segments of sequences within the transcripts, put candidate controlling elements in different genes see if this affects their splicing as well.

Question 101

A specific balanced translocation is found to be associated with mental retardation in five unrelated children. The breakpoints do not disrupt any known transcripts and the closet mapped gene is 50 kb from the breakpoints. What are two possible explanations for the phenotype caused by the translocation? What experiments would you design to test each?

Answer 101

Could mess up regulatory elements (enhancer interacting with promoter) – to test this you could do 3C This is actually a transcript (ncRNA, etc) – to RT-PCR for the transcript with probes around the breakpoint

Question 102

What is the subcompartment formed between the inner and outer mitochondrial membranes? Describe one process that occurs here.

Answer 102

Intermembrane space Oxidative phosphorylation (the metabolic pathway in which the mitochondria in cells use their struc-ture, enzymes, and energy released by oxidation of nutrients to reform ATP).

Question 103

What is the enzyme in the inner mitochondrial membrane that catalyzes the formation of ATP from ADP and inorganic phosphate? What does this enzyme need to produce ATP?

Answer 103

ATP synthase
Repiratory complexes 1-5 (electron transport)
Needs ADP + P and inflow of protons

Question 104

What type of cell-cell signaling involves direct interactions between cells? Name one class of proteins that are required for this type of signaling.

Answer 104

Juxtacrine signaling, extracellular matrix proteins are required for this notch protein is required for notch-signaling (a type of juxtacrine signaling)

Question 105

Describe the sequence motifs associated with secretory signal sequences and transmembrane domains.

Answer 105

N-terminal signal sequence is recognized by an SRP during protein synthesis (on the ribosome), transferred to a SRP receptor on the ER, where the nascent protein is inserted into the Sec61 translocation complex. In secretory proteins and type I transmembrane proteins, signal sequence immediately cleaved once translocated into the ER by signal peptidase. The signal sequence of type II membrane proteins and some polytopic membrane proteins are not cleaved off and therefore are referred to as signal anchor sequences. Within the ER, the protein is first covered by a chaperone protein to protect it from the high concentration of other proteins in the ER, giving it time to fold correctly. Once folded, the protein is modified as needed (i.e. glycosylation), then transported to the Golgi apparatus for further processing and goes to its target organelles or is retained in the ER.The secretory proteins aggregate with each other or bind receptors in the golgi into vesicles by sorting-for-entry(enrich before budding vesicle) and/or sorting-by-retention(bud off stuff and send back what should stay in golgi) models. Each secreted molecule has their own specific motif. The amino acid chain of transmembrane proteins, which often are transmembrane receptors, passes through a membrane one or several times. They are inserted into the membrane by translocation, until the process is interrupted by a stop-transfer sequence, also called a membrane anchor sequence. Similar targeting model as secretory proteins. However, many complex multi-transmembrane proteins contain structural aspects that do not fit the model. Seven transmembrane G-protein coupled receptors do not have an amino-terminal signal sequence. In contrast to secretory proteins, the first transmembrane domain acts as the first signal sequence, targets amino terminus into ER membrane.

Question 106

Discuss TWO computational approaches that might reasonably be exploited to recognize rec-ognize these motifs. Which of these do you think would be most successful, and why?

Answer 106

Search for a particular protein sequence such as KDEL in protein sequences. Simple pattern find-ing/matching problem. Another approach is to search for structure that leader sequences or N-terminal motifs possess. After modeling the 3D crystal structure or determining the electron density of the signal sequence, fit new sequences to the structures to find similar sequences. Then perform pattern matching on new sequences to identify motifs. The second approach is more complex might be more successful because sequences are recognized by receptor proteins because of structure and 3D shape.

Question 107

Describe the machinery involved in trafficking of both secreted and transmembrane proteins.

Answer 107

The transmembrane protein is translated a bit, recognized by a signal recognition particle and then docked onto the ER. The peptide chain has start and stop transfer sequences which encode the trans-membrane helicies so multiple passes are made through the membrane. Then it goes to the golgi for processing/PTMs/folding before getting sent to the plasma membrane. Adaptor proteins associated with coat proteins such as COPI and COPII recognize sequences in pro-teins that signal they need to be exported or retained in the endoplasmic reticulum. COPII proteins are associated with secretory vesicles or proteins exported whereas COPI retrieves protein residents of the ER. SNARE proteins are critical for fusion of vesicles with membranes and other vesicles by facilitating recognition and specificity for certain targets.

Question 108

Proteins encoded in the eukaryotic nucleus are also targeted into mitochondria and chloroplasts. Describe the sequence motifs and machinery involved in trafficking into one of these endosymbiotic organelles.

Answer 108

Mitochondria have protein translocators include outer membrane TOM proteins with receptors and translocation channels and SAM complex. The inner membrane channels include TIM22, TIM23(also docked in outer membrane) and OXA complexes. Directed by N-terminal sequence with positive and neutral charge faced amphipathic alpha helix.

Question 109

Most mitochondrial and plastid proteins derive from genes thought to have been transferred from the organellar genome into the nucleus. How would you test this hypothesis?

Answer 109

Assuming this is true, we can validate/test this hypothesis by comparing characteristics of the mi-tochondrial or plastid proteins similar to an organellar genome versus the host genome. We can see whether there is a codon bias or tendency to use certain amino acids in these mitochondrial or plastid proteins that are more similar to other mitochondrial proteins encoded in the mitochondrial genome

Question 110

What challenges might be associated with transferring endosymbiotic genes into the nucleus … and how could these be solved?

Answer 110

In order for the protein of the endosymbiotic gene to be imported back into the organelle (mito-chondria/chloroplast) there need to be specific signal sequences in the protein to facilitate their export from the cytoplasm into the organelle. This challenge can be solved by the proteins acquisition of sequences that mitochondria receptors can recognize or evolution of receptors to recognize organelle specific proteins.

Question 111

Describe the ‘endosymbiotic theory’ of organelle formation and some evidence in favor of this idea.

Answer 111

mitochondria originated as separate prokaryotic organisms that were taken inside the cell as endosym-bionts. Evidence: surrounded by two membranes, has ribosomes that are like those found in bacteria, have similar enzymes to those of prokaryotes, has its own genome

Question 112

Briefly describe the role of Endoplasmic Reticulum (ER) and Golgi Complex in cellular function.

Answer 112

Endoplasmic Reticulum: rough ER synthesizes protein and smooth ER synthesizes lipids and steroids, metabolizes carbs and steroids and regulates calcium concentration, drug detoxification and attach-ment of receptors on cell membrane.
Golgi complex: integral in modifying, sorting, and packaging these macromolecules for cell secretion (exocytosis) or use within the cell. It primarily modifies proteins delivered from the rough endoplasmic.

Question 113

In eukaryots, genes are transcribed in the nucleus, mRNAs are translated in the cytoplasm, and the protein products of these mRNAs can end up in many different cellular compartments (nucleus, cytoplasm, plasma membrane, organelles etc.). What determines cellular localization of a protein? Provide three examples.

Answer 113

localization signal on mRNA: so mRNA translated in specified location signal peptide: guides to ER and secretory pathway nuclear localization signal: on peptide to import protein back into nucleus mitochondrial localization signal on peptide, etc.

Question 114

The genome of a previously uncharacterized unicellular eukaryote has recently been sequenced. This organism has a double membrane-bound organelle that appears to contain proteins. You are interested in identifying the proteins located in this organelle. How would you go about doing this computationally? Describe two experimental methods that could be used to test your predictions.

Answer 114

BLAST and look for orthologs in other related species and only concern yourself with those orthologs that are found to map to proteins that are known to be expressed in other double membrane bound organelles (mitochondria, etc.)
Fractionate out what is found in the organelle and do mass spec see if predicted genes have a consensus ‘localization sequence’ = attach to luciferase and see if it goes to the organelle tag predicted proteins with GFP and see where they are expressed

Question 115

If you were responsible for annotating the genome of an unknown eukaryotic organism (and had unlimited computational and wet-lab resource), how would you go about identifying and distinguishing proteins associated with each of the following subcellular organelles: nucleus, plasma membrane, ER, centrioles, peroxisomes, and mitochondria.

Answer 115

subcellular fractionation and mass spec everything – sequence and map back to genome allowing for gaps

Question 116

Outline the biochemical events underlying activation of a heterotrimeric G-protein by an agonist-activated 7-transmembrane receptor. How is activation terminated?

Answer 116

A signal binds to the 7-transmembrane receptor which facilitates the switching of GDP to GTP in the G-protein so the G-protein becomes activated. Once the GPCR recognizes a ligand, the shape (conformation) of the receptor changes to mechanically activate the G protein, and causes one subunit (Gα) to bind a molecule of GTP (causing activation) and dissociate from the other two G-protein subunits(Gβ and Gγ). The dissociation exposes sites on the G-protein subunits that interact with other molecules. The activated G protein subunits detach from the receptor and initiate signaling from many downstream effector proteins. The activation is terminated when Gα hydrolyzes the GTP to GDP and reassociates with Gβ and Gα. GTPase-activating proteins accelerate hydrolysis of GTP to GDP.

Question 117

What are the 4 major classes of heterotrimeric G proteins and how do they differ from each other?

Answer 117

Gαs: activates the cAMP-dependent pathway by stimulating production of cAMP from ATP Gαi: inhibits the production of cAMP from ATP Gαq: stimulates membrane-bound phospholipase C beta, which cleaves PIP 2 Gα12/13: are involved in Rho family GTPase signaling and control cell cytoskeleton remodeling

Question 118

What is the enzyme that cleaves inositol phospholipids into diacylglycerol (DAG) and inositol triphosphate (IP3)? Why are DAG and IP3 important to cell biology?

Answer 118

Phospholipase-C (PLC) cleaves phospholipids (PIP2) into DAG and IP3 (2nd messengers). DAG acti-vates protein kinase C (PKC); IP3 opens IP3-gated Ca2+ release channel on the endoplasmic reticulum, the Ca2+ also activates PKC. DAG and IP3 are second messengers- signaling molecules released by the cell to trigger physiolog-ical changes; the cell releases second messenger molecules in response to extracellular signals (first messengers)

Question 119

What type of hormone can freely diffuse through the plasma membrane of eukaryotic cells? What type of receptor binds to this class of hormones and how do they function?

Answer 119

Steroids Steroid hormone receptors, there are many different types including nuclear receptors, and some G-protein coupled receptors and ion channels that act as cell surface receptors Some are located in cytosol, bind to steroid and then are transported to nucleus to act upon transcription. Some are located in the nucleus, wait for a steroid hormone to enter the nucleus and then bind and act upon transcription. Some are located in the plasma membrane.

Question 120

What is a hydrophobic signaling molecule with a characteristic four-ringed structure derived from cholesterol? Name one process that this molecule regulates.

Answer 120

Steroids, regulate transcription bind to steroid receptors and once in the nucleus, the steroid-receptor ligand complex binds to specific DNA sequences and induces transcription of its target genes

Question 121

Name two genes that belong in the receptor tyrosine kinase family.

Answer 121

EGF receptor, VEGF receptor

Question 122

Name two components of the Wnt signaling pathway (other than Wnt).

Answer 122

c-myc, c-jun

Question 123

Choose a signaling pathway such as MAPK or WNT and enumerate at least one sequence of signal cascade from the receptor to transcription factor.

Answer 123

MAPK/ERK pathway: the ligand (called epidermal growth factor (EGF)) binds to the receptor (called EGFR). This activates the receptor to phosphorylate iteslf. The phosphorylated receptor binds to an adaptor protein (GRB2), which couples the signal to further downstream signaling processes. For example, one of the signal transduction pathways that are activated is called the mitogen-activatedprotein kinase (MAPK) pathway. The signal transduction component labeled as “MAPK” in the path-way was originally called “ERK,” so the pathway is called the MAPK/ERK pathway. The MAPK protein is an ensyme, a protein kinase that can attach phosphate to target proteins such as the tran-scription factor MYC and, thus, alter gene transcription and, ultimately, cell cycle progression.

Question 124

You are studying a signaling pathway in which the extracellular signaling molecule (Stabilizer) results in the stabilization of the activating protein in the pathway, Protein X, which is a transcription factor. You find that in cells that no longer produce functional Protein Y this signaling pathway is constitutively active even in the absence of Stabilizer. Name 3 types of proteins that Protein Y could be and describe specifically how they would regulate Protein X function.

Answer 124

Transcriptional repressor ; Proteolytically degrade; Binds functional domain of X