Topic 8B: Genome Projects and Gene Technologies

Question 1

What is a genome?

Answer 1

The entire set of DNA in an organism

Question 2

What is a proteome?

Answer 2

All of the proteins which an organism can make.

Question 3

Sequencing proteomes: Simple organisms (prokaryotes)

Answer 3

It is easy to sequence the proteome of simple organisms because:
•They have no introns.
•They have no histones.
•Located in cytoplasm.
•Fewer bases.

Question 4

Sequencing proteomes: Complex organisms (Eukaryotes)

Answer 4

It hard to sequence the proteome of complex organisms because:
•They have introns.
•They have histones.
•Located in nucleus.
•Many bases.

Question 5

Benefits of sequencing proteomes of simple organisms

Answer 5

• Can help to identify antibiotic resistant factors and therefore help us to manage the spread of diseases.
• Allows us to identify antigens in the surface of pathogens and viruses to help develop vaccines.

Question 6

Why are new sequencing methods more effective?

Answer 6

They are often automated, more cost-effective and can be done on a large scale.

Question 7

What is recombinant DNA technology?

Answer 7

The transfer of a fragment of DNA from on organism to another, which can then be used to produce protein cells in the recipient organism (due to the universal nature of the genetic code)

Question 8

Making DNA fragments: Using reverse transcriptase

Answer 8

1) Isolate mRNA from cells.
2) Mix mRNA with free DNA nucleotides and reverse transcriptase.
3) The reverse transcriptase uses mRNA as a template to synthesis new strands of complementary DNA (cDNA).

Question 9

Making DNA fragments: Using restriction endonuclease enzymes

Answer 9

1) Restriction endonuclease enzymes catalyses the hydrolysis of DNA at specific palindromic sequences (recognition sequences) complementary to the enzyme’s active site.
2) Sometimes, this leaves sticky ends (small tails of unpaired bases) which can be used to bind to another DNA molecule with a complementary sequence.

Question 10

Making DNA fragments: Using a gene machine

Answer 10

1) The sequence that is required is designed, and the first nucleotide of the sequence is fixed to a support (usually a bead).
2) Nucleotides are then added in the correct order step-by-step.
3) Protecting groups are also added to make sure the nucleotides are joined at the right points , to prevent unwanted branching.
4) Short sections of DNA called oligonucleotides are produced, which are then broken off from the support, and joined together to make longer DNA fragments.

Question 11

What are palindromic sequences?

Answer 11

Sequences consisting of anti-parallel base pairs that read the same in opposite directions.

G A A T T C
C T T A A G

Question 12

What does amplifying DNA fragments mean?

Answer 12

Making many copies of a fragment of DNA.

Question 13

What is in vivo cloning?

Answer 13

When gene copies are made within a living organism.

Question 14

What is in vitro cloning?

Answer 14

When gene copies are made outside of a living organism (using the polymerase chain reaction)

Question 15

What are the different processes involved in ‘in vivo cloning’?

Answer 15

1) Making recombinant DNA.
2) Transforming cells.
3) Identifying transformed cells.

Question 16

In vivo cloning: Making recombinant DNA

Answer 16

1) Isolate the vector DNA and cut it open (using the same restriction endonuclease that was used to isolate the DNA fragment containing the target gene).
2) Mix the vector DNA and DNA fragment with DNA ligase which joins their sticky ends together in a process called ligation.
3) This produces a new combination of DNA called recombinant DNA.

Question 17

What is a vector?

Answer 17

Something that transfers DNA into a cell:
• Plasmids
• Bacteriophages

Question 18

In vivo cloning: Transforming cells

Answer 18

1) The vector containing the recombinant DNA transfers the gene into the host cell, causing it to be transformed.

NOTE: If a plasmid vector is used, the host cell will have to be persuaded to take it up through heat-shocking the cell.

Question 19

In vivo cloning: Identifying transformed cells

Answer 19

1) Marker genes are inserted onto vectors, and transferred along with the gene into the host cell.
2) Host cells are then grown on an agar plate allowing them to divide and replicate their DNA, creating colonies of cloned cells.
3) Any transformed host cells contain both the target and marker genes.
4) The marker genes code for antibiotic resistance or fluorescence, meaning transformed host cells are not killed by particular antibiotics, or fluoresce under UV light.
5) This allows you to identify transformed host cells which contain the target gene, allowing you to grow them even more, producing many copies of the cloned gene.

Question 20

What are marker genes?

Answer 20

Genes that are inserted in to vectors and code for specific characteristics to allow you to identify which cells have been transformed.

• Antibiotic resistance
• Fluorescence

Question 21

What are promoted regions?

Answer 21

DNA sequences which fell RNA polymerase where to start and stop producing mRNA.

Question 22

In vitro cloning: Polymerase chain reaction (PCR)

Answer 22

1) Produce a reaction mixture containing the DNA fragment, free nucleotides, primers and DNA polymerase.
2) Heat the DNA mixture to 95 degrees in order to break the hydrogen bonds between the two strands of DNA (in the DNA fragment).
3) Cool the mixture to 50-65 degrees to allow the primers to bind to each DNA template strand.
4) Heat the reaction mixture to 72 degrees to allow DNA polymerase to join together free DNA nucleotides which have lined up alongside each DNA template strand through complementary base pairing.
5) This forms complementary DNA strands.

Question 23

What is the feature of the PCR?

Answer 23

Each cycle doubles the amount of DNA.

2 strands -> 4 strands -> 8 strands
1 molecule -> 2 molecules -> 4 molecules

Question 24

What are primers?

Answer 24

Short pieces of DNA that bind to the DNA template through complementary base pairing which allow DNA polymerase to bind.

Question 25

What are transformed organisms?

Answer 25

Organisms which have recombinant DNA inserted into them through genetic engineering.

(Also known as genetically modified organisms)

Question 26

How are transformed plants produced?

Answer 26

1) A gene that codes for a desirable protein is inserted into a plasmid.
2) Then, the plasmid is added to a bacterium which is used as a vector to carry the gene into the plant cells.
3) If the right promoter region is added along with the gene, the transformed cells will be able to produce the desired protein.

Question 27

How are transformed animals produced?

Answer 27

1) A gene that codes for a desirable protein is inserted into an egg or early embryo.
2) Therefore, all of the resulting cells contain the gene.

Question 28

Benefits / concerns with transformed organisms: Agriculture

Answer 28

✔️ Resistance to pests = reduced costs of pesticides.
✔️ Increased yield / nutritional values.
✔️ Resistance to drought = able to survive with little water.

✖️Transformed crops may interbreed with wild plants to produce ‘superweeds’.
✖️ Contamination of organic crops.
✖️ Uncontrolled spread of recombinant DNA.

Question 29

Benefits / concerns with transformed organisms: Medicine

Answer 29

✔️ Allows for cheap production of medicines.
✔️ Allows for quick production.
✔️ Allows medicines to be produced in large quantities.

✖️Technology may be used unethically (e.g. to produce designer babies).
✖️ Ownership issues over genetic material.
✖️ Companies owning genetic engineering technologies may limit use of technologies which could be saving lives.

Question 30

Benefits / concerns with transformed organisms: Industry

Answer 30

✔️ Produce larger quantities for less money.
✔️ Can replace substances which were previously produced from killing animals.

✖️ Companies could grow too big + powerful forcing smaller companies out of business.
✖️ Purification of proteins may lead to introduction of toxins into food industry.

Question 31

What is gene therapy?

Answer 31

The use of DNA technology to treat human diseases, by altering the defective genes inside cells.

Question 32

Gene therapy: Supplementary therapy

Answer 32

When you add a working dominant allele to two mutated recessive alleles.

Question 33

Gene therapy: Silence therapy

Answer 33

A piece of DNA is added to the middle of a mutated dominant allele so that it doesn’t work anymore.

Question 34

Gene therapy: Somatic therapy

Answer 34

Altering alleles in the body cells, instead of the sex cells meaning offspring could still inherit the disease.

Question 35

Gene therapy: Germ line therapy

Answer 35

Involves altering the alleles in the sex cells, meaning every cell of the offspring won’t suffer from the disease.

This is illegal in the UK.

Question 36

Ethical issues surrounding gene therapy?

Answer 36

May be used to treat cosmetic effects or create designer babies.

Question 37

How are alleles located using gene therapy?

Answer 37

1) Restriction enzymes are used to digest a sample of DNA into fragments which are separated using electrophoresis.
2) They are then transferred to a nylon membrane and incubated with a fluorescently labelled DNA probe.
3) If the allele is present, the DNA probe will bind to it, and will fluoresce under a UV light.

NOTE) Make sure to wash away unbound probes so only the DNA probes complementary to the alleles fluoresce.

Question 38

What are DNA probes?

Answer 38

Short single strands of DNA which have a specific base sequence, complementary to that of the target allele. It also has a label attached so you can detect it to identify whether a person has a specific allele of a gene.

Question 39

What are the different labels which may be attached to a DNA probe?

Answer 39

• Radioactive labels

* Fluorescent labels

Question 40

What is a DNA microarray?

Answer 40

A glass slide with microscopic spots of different DNA probes attached to it. This allows you to test for many different mutated genes at the same time. This is a process known as genetic screening.

Question 41

Why is it helpful to locate alleles using DNA probes?

Answer 41

It is a way of testing for mutated alleles.

Question 42

What is genetic counselling?

Answer 42

1) Genetic screening is carried out using a DNA microarray and DNA probes.
2) The results are then used to advise patients and their relatives about the risks of genetic disorders.
3) It can then be used to discuss the most effective treatments for any positive results.

Question 43

Personalised medicine

Answer 43

Different people respond to the same drug in different ways - making certain drugs more effective for some people than others. Therefore, personalised medicines which are tailored to an individual’s DNA are used for more effective treatment.

Question 44

How do you set up a DNA microarray?

Answer 44

1) Use reverse transcriptase to produce complementary DNA (cDNA) from mRNA obtained from the target cell.
2) Then, add a fluorescent label to the cDNA and wash it over the array.
3) If the DNA probes attached to the array are complementary to the cDNA, they will bind together.
4) Wash away the unbound cDNA.
5) Then, shine a UV light over the microarray, and if any cDNA have bound, they will fluoresce.

Question 45

What are variable number tandem repeats (VNTR’s)?

Answer 45

Base sequences that don’t code for proteins and repeat next to each other over and over. The number of repeats varies in each person and so the length of these sequences differ too.

e.g. CATGCATGCATGCATGCATGCATG

Question 46

What is genetic fingerprinting?

Answer 46

Comparing the number of times a sequence is repeated at different places in the genome between individuals.

Question 47

What is the probability of individuals having having the same genetic fingerprint?

Answer 47

Very low because the chance of two individuals having the same number of VNTR’s at each place they’re found in DNA is very low.

Question 48

How do you produce a genetic fingertip?

Answer 48

1) Obtain a sample of DNA and use the PCR to make many copies of the areas of DNA which contain the VNTR’s.
2) Add a fluorescent tag to all of the DNA fragments so they can be viewed under UV light.
3) Separate the DNA fragments through gel electrophoresis, to create a pattern of bands depending on the length of the fragments.
4) Place the gel under a UV light, where the DNA fragments will be seen as bands, which make up the genetic fingerprint.
5) You can then compare genetic fingerprints to see if bands appear at the same location, meaning two people have the same number of VNTR’s at that place.

Question 49

How does feel electrophoresis work?

Answer 49

1) Place the DNA mixture into a well in a slab of gel and cover in an electricity conducting buffer solution.
2) Pass an electrical current through the gel, which causes the fragments to move towards the positive electrode due to the fact that they are slightly negatively charged.
3) Shorter DNA fragments move faster and travel further through the gel meaning they are separated according to length.
4) This produces a pattern of bands.

Question 50

Uses of genetic fingerprinting: Determining genetic relationships

Answer 50

1) We inherit VNTR base sequences from our parents, with roughly half from each parent.
2) This means the bands on our genetic fingerprint match closely with our parents.

Question 51

Uses of genetic fingerprints: Determining genetic variability within a population

Answer 51

1) The greater the number of bands that don’t match on a genetic fingerprint, the more genetically different individuals are.
2) Therefore, you can compare the number of repeats at several places in the genome for a population to find out how genetically varied it is.

Question 52

Uses of genetic fingertips: Forensic science

Answer 52

1) Genetic fingertips can be used to compare samples of DNA found at the crime scene to samples of DNA from a possible suspect.
2) If the samples match, the suspect must have been at the crime scene.

Question 53

Uses of genetic fingertips: Medical diagnosis

Answer 53

1) A genetic fingerprint can refer to a unique pattern of several alleles to diagnose genetic orders and cancer.
2) This allows you to detect a broader genetic pattern.

Question 54

Uses of genetic fingerprints: Animal and plant breeding

Answer 54

1) Genetic fingerprinting can be used to prevent interbreeding which decreases the gene pool.
2) It is used to identify the least related individuals in a population so that we can breed them together.