Section 12: Classification And Evolution Flashcards
What is classification?
Classification is act of arranging organisms into groups based on their similarities and differences. This makes it easier for scientists to identify them and study them. Taxonomy is the study of classification. There are a few different classification systems in use but they will involve placing organisms into groups in a taxonomic hierarchy. In the hierarchy you need to know about, there are eight levels of groups (called taxonomic groups). Similar organisms are first sorted into one of three very large groups called domains, e.g. animals, plants and fungi are in the Eukarya domain. Similar organisms are then sorted into slightly smaller groups called kingdoms, e.g. all animals are in the animal kingdom (Animalia). Similar organisms from that kingdom are then grouped into a phylum. Similar organisms from each phylum are then grouped into a class, and so on down the eight levels of the taxonomic hierarchy.
As you move down the hierarchy, there are more groups At each level but fewer organisms in each group. The hierarchy ends with species – the group that contains only one type of organism (e.g. humans, dogs, E. coli and about 50 million other living species).
What are the eight levels of the taxonomic hierarchy in order?
Domain. Kingdom. Phylum. Class. Order. Family. Genus. Species.
Give an example of the classification of humans.
Domain = Eukarya, kingdom - animalia, phylum - Chordata, class = mammalia, order = primates, family = hominidae, genus - homo, species = sapiens.
How do we name species?
The nomenclature (naming system) used for classification is called the binomial system – all organisms are given one internationally excepted scientific name in Latin that has two parts. The first part of the name is the genus name and has a capital letter. The second part is the species name and begins with a lowercase letter. Names are always written in italics (or they are underlined if they’re handwritten). The binomial system helps to avoid the confusion of using common names. For example, Americans call a type of bird cockatoos and Australians call them flaming galahs, but it’s the same bird. If the correct scientific name is used – Eolophus roseicappilus – there is no confusion.
Give examples of naming species.
Humans are Homo sapiens – the genius is homo and the species is sapiens.
Dogs are Canis familiaris– the genius is Canis and the species is familiaris.
Cats are Felis catus– the genus is Felis and the species is catus.
What are the five kingdoms and give examples and features of each.
Prokaryotae. An example of this is bacteria. Features are that they are prokaryotic, the are unicellular (single celled), they have no nucleus and they are less than 5nm
Protoctista. An example of this is algae and Protozoa. Features are that they are eukaryotic cells, usually live in water, are single celled or simple multicellular organisms.
Fungi. An example of these are moulds, yeasts and mushrooms. Features are that they are eukaryotic, they have a chitin cell wall, they are saprotrophic (they absorb substances from dead or decaying organisms), they are single celled or multicellular organisms.
Plantae. An example of these are mosses, ferns and flowering plants. Features are that they are eukaryotic, multicellular, have cell walls made of cellulose, can photosynthesise, contain chlorophyll. Are autotrophic (produce their own food).
Animalia. examples of these are nematodes (roundworms), molluscs, insect’s, fish, reptiles, birds and mammals. Features are that they are eukaryotic, they are multicellular, they have no cell walls, they are heterotrophic (consume plants and animals).
What is phylogeny?
Evolution is a gradual change of organisms over time. It has led to a huge variety of different organisms on Earth, all of which share a common ancestry. Phylogeny is the study of he evolutionary history of groups of organisms. Phylogeny tells us who’s related to whom and how closely related they are. This can be shown on a phylogenetic tree.
Describe a phylogenetic tree.
The first branch point represents a common ancestor of all the family members. Each of the following branch points represent another common ancestor from which a different group diverged.
According to phylogenetics, the species is the smallest group that shares a common ancestor – in other words, the end of a branch on a phylogenetic tree. Classification systems now take into account phylogeny when arranging organisms into groups. Classifying organisms in this way is known as cladistics.
What is the evidence for classification and give examples.
Early classification systems only use observable features (things you can see) to place organisms into groups. Observable features can be anatomical (structural), e.g. how many legs an organism has, or behavioural, e.g. whether an organism lives in groups. But this method has problems. Scientists don’t always agree on the relative importance of different features in groups based solely on physical features may not show her related organisms are.
For example sharks and whales look quite similar and they both live in the sea. But they’re not actually closely related – sharks are cartilaginous fish (meaning they have skeletons made of cartilage instead of bone it) – where as whales are vertebrae mammals (they have a backbone), they are from two completely different classes.
Classification systems are now based on observable features along with other evidence. This evidence tells us how similar, and therefore how closely related, organisms are. The types of evidence taxonomists look at include embryological evidence (the similarities in the early stages of an organism development), fossil evidence and molecular evidence.
What is the molecular evidence of classification? And give an example.
Gathering molecular evidence involves analysing the similarities in proteins and DNA. More closely related organisms will have more similar molecules. You can compare things like how DNA is stored and the sequence of DNA bases.
An example;
The diagram below shows part of the DNA base sequence for gene X in three different species…
Species A; ATTGTCTGATTGGTGCTAGTCGTCGATGCTAGGTCG
Species B; ATTGTATGATTGGTGCTAGTCGGCGATGCTAGGTCG
Species C; ATTGATTGAAAGGAGCTACTCGTAGATATAAGGGGT
There are 13 differences between the base sequences in species a and c but only 2 differences between the base sequences in species a and b. This suggests that species a and b are more closely related than a and c.
You can also compare the sequence of amino acids in proteins from different organisms.
For example, cytochrome c is a short protein found in many species. The more similar the amino acid sequence of cytochrome c in two different species, the more closely related the species are likely to be.
What is variation?
Variation is the differences that exist between individuals. Every individual organism is unique – even clones (such as identical twins) shows some variation. It can occur within species or between species.
How does variation occur within species, give an example.
Variation within a species is called intraspecific variation. For example individual European Robins weigh between 16 g and 22 g and show some variation in many other characteristics including length, wingspan, colour and beak size.
How does variation occur between species, and give examples.
The variation between different species is called interspecific variation. For example the lightest species of bird is the bee humming bird, which weighs around 1.6 g on average. The heaviest species of bird is the ostrich, which can weigh up to 160 kg (100,000 times as much).
What is continuous variation and when does it occur, give examples.
Continuous variation is when the individuals in a population vary within a range – there are no distinct categories.
For example, in animals, continuous variation occurs in:
Height – humans can be any height within a range (e.g. 139 cm, 175 cm, 185.9 cm etc.), not just tall or short. Mass - humans can be any mass within a range, milk yield - cows can produce any volume of milk within a range.
For example, in plants, continuous variations occurs in:
Surface area of leaves - the surface area of each of a tree’s leaves can be any value within a range, mass - the mass of the seeds from a flower head varies within a range.
For example, in microorganisms, continuous variation occurs in:
Width - the width of E.coli bacteria varies within a range, length - the length of the flagellum can vary within a range.
What are adaptations?
All the variation between and within species means that some organisms are better adapted to their environment than others. Being adapted to an environment means an organism has features that increase its chances of survival and reproduction, and also the chances of its offspring reproducing successfully. These features are called adaptations and can be behavioural, physiological and anatomical.
Adaptations develop because of evolution by natural selection. In each generation, the best-adapted individuals are more likely to survive and reproduce - passing on the alleles for their adaptations to their offspring. Individuals that are less well adapted are more likely to die before reproducing.
