Repetitive DNA-STRs, Gene structure and expression

Question 1

the human genome

Answer 1

look on ppt

Question 2

what is repetitive DNA

Answer 2

tandem repeats

interspersed repeats

Question 3

tandem repeats

Answer 3

• – Satellites
• – Minisatellites
• – Microsatellites aka STRs (short tandem repeats), SSRs (simple sequence repeats)

Question 4

interspersed repeats

Answer 4

• – LINES
• – SINES
• – LTRs
• – Transposons

Question 5

Interspersed repetitive DNA

- nearly half the genome derives from what

Answer 5

transposable elements (TEs)

They abundant in gene sequences and are also present in a significant portion of mature mRNAs, mostly in their untranslated regions.

Question 6

transposable elements (TEs)

Answer 6

• fundamental components of most eukaryotic genomes, with important contributions to their size, structure and variation.
• ## They occur as families with a variable copy number and they are (or were) able to transpose from one locus to another.

Question 7

what is the most abundant among different TEs

Answer 7

the primate-specific Alu sequences (SINEs) are the most abundant and their 1.1 million copies account for more than 10% of the human genome!

Question 8

Class I elements (interspersed repetitive)

Answer 8

• also called retroelements, can be divided into LTR retrotransposons
• which are flanked by long terminal repeats (LTRs) sharing an over-all organization similar to retroviruses and non-LTR retrotransposons
• which terminate at one end with a poly(A) tract and have structural features of long and short interspersed nuclear elements (LINEs and SINEs, respectively).

Question 9

LTR retrotransposons have been further classified as either

Answer 9

• gypsy/Ty3-like or copia/Ty1-like elements based on the order of their encoded proteins, that include a reverse transcriptase (RT) and integrase (IN)

Question 10

class II elements ((DNA) transposons)

Answer 10

• characterized by terminal inverted repeats (TIRs)

have been grouped into superfamilies on the basis of the target site duplication, the presence or not of the DDE triad (acidic amino acid motif), the sequence similarities at the DNA and protein levels (e.g. Tc1/mariner, hAT, Mutator-like, CACTA).

Question 11

how are most DNA transposons organized

Answer 11

in families of autonomous and non autonomous elements, characterized by their ability to respond to the same transposase.

Question 12

satellite DNA

Answer 12

α (alphoid) 171bp, centromeres
β (Sau3A) 68bp, certain centromeres
Sat 1 25-48bp most centromeres
Sat 2 & 3 5bp all chromosomes

Question 13

minisatellite DNA

Answer 13

Telomeric >6bp all telomeres

Hypervariable 9-64 many near telomeres

Question 14

microsatellite DNA

Answer 14

• Microsatellite DNA = SSR = STR

SSRs <10bp (or <6bp), dispersed

Question 15

what did alec jeffereys discover

Answer 15

the so called hypervariable minisatellites which are repetitive sequences within the DNA.

Question 16

• Composition and length of hypervariable minisatellites

Answer 16

varies between individuals, even within the same species.

Question 17

what may be present within these minisatelite regions

Answer 17

• There may be interspersed polymorphic restriction sites within these minisatellite regions.

Question 18

treating the DNA in hypervariable minisatellites with endonucleases does what

Answer 18

cleaves the DNA into fragments to create a pattern that is unique to each individual. Using the Southern blotting technique, the patterns of restriction fragments can be viewed.
• This results in a barcode-like pattern which is unique to the individual. This became known as DNA fingerprinting.

Question 19

advances to DNA fingerprinting

Answer 19

• There have been several advances to this approach which provides a simple pattern with high discriminatory power.
• However, requires a large amount of sample material for the analyses, which is a disadvantage in criminal applications. In addition, inter-laboratory standardisation has been difficult to achieve and its relatively slow and expensive and difficult.
• PCR of STR loci has overcome these difficulties and has greatly enhanced the role of DNA profiling in forensic science.

Question 20

STRs are dispersed where

Answer 20

short tandem repeats are dispersed throughout the whole genome and can be found in large numbers, even in the gene introns

Question 21

whats the most common STR

Answer 21

Dinucleotide polymorphisms are the most common STRs (ignoring mononucleotide) but they are strongly affected by strand slippage during amplification, producing artefactual stutter bands.

Question 22

what is less prone to slippage

Answer 22

• Tetra- and pentanucleotide repeats are less prone to slippage and are therefore more suitable for forensic analyses.

Question 23

STR methods can be..

Answer 23

can be easily standardised and are suitable for multiplexing. Amplicon (PCR product) length measurement is automated; its cheap, quick, accurate and easy.

Question 24

• Short tandem repeats (STRs), simple sequence repeats (SSRs) or microsatellites are defined as

Answer 24

tandemly repeated tracts of DNA composed of 1–6 base pair long motifs.

Question 25

the number of repeats in a tract

Answer 25

usually less than ten and if it is higher then repeat length polymorphism is often observed. In rare cases, the repeat number may reach hundreds and even thousands.

Question 26

All SSRs taken together occupy how much of the human genome

Answer 26

about 3% - in which they are widely dispersed and associated with many genes.

Question 27

STR locus examples

Answer 27

• XXXAGAGAGAGAGAGAGAGAGAGAGAGAGAGXXX = AN STR (AG Dinucleotide motif repeated)
• XXXAGGCTTATCATGCAGCTACTACGAGTCAXXX = NOT AN STR (AG Motif not tandemly repeated i.e. There is sequence in between the AG Motifs. Tandemly implies nothing between the repeats although we will see that’s overly simple)
• XXXAGATAGATAGATAGATAGATAGATAGATXXX = AN STR (A tetranuleotide AGAT repeat. Tetranucleotide repeats are the most commonly used in forensics science)
• A LENGTH POLYMORPHISM (P0LYMORPHISM = OCCURRING IN SEVERAL DIFFERENT FORMS, IN THIS CASE DIFFERENT LENGTHS)
• XXXAGATAGATAGATAGATAGATAGATAGATAGATXXX = AGAT REPEATED 8 TIMES
• XXXAGATAGATAGATAGATAGATXXX = AGAT REPEATED 5 TIMES
• “XXX” represents the DNA sequence either side of the STR.

Question 28

at each STR locus there are two alleles

Answer 28

an individual will either be

• Homozygous (both alleles the same)
• Heterozygous (alleles different)

Question 29

homozygous example

Answer 29

XXXAGATAGATAGATAGATAGATAGATAGATAGATXXX = AGAT REPEATED 8 TIMES
XXXAGATAGATAGATAGATAGATAGATAGATAGATXXX = AGAT REPEATED 8 TIMES
Reported as 8,8 genotype

Question 30

heterozygous exmaple

Answer 30

XXXAGATAGATAGATAGATAGATAGATAGATAGATXXX = AGAT REPEATED 8 TIMES
XXXAGATAGATAGATAGATAGATXXX = AGAT REPEATED 5 TIMES
Reported as 5,8 genotype

Question 31

the genomic distribution of the SSRs

Answer 31

• The genomic distribution of the SSRs of different motif lengths and sequences is strongly biased. With the exception of monomeric motifs, the classes of repeated dimers, tetramers and hexamers, which show nearly equal density in the genome, are 3–4 times more abundant than those of trimers and pentamers

Question 32

SSRs in different functional groups

Answer 32

most of them show much higher density in non-coding regions

Question 33

exceptions

Answer 33

• Exceptions to the rule are trimers and hexamers which are nearly two times more prevalent in exons compared to introns and intergenic regions

Question 34

micro-satellite density in the human genome

Answer 34

• In the human (and mouse) genome, microsatellite density is nearly twofold higher near the ends of chromosome arms.

Question 35

where are microsatellites also frequently found

Answer 35

in the proximity of interspersed repetitive elements such as short interspersed repeats (SINEs) and long interspersed elements (LINEs).

Question 36

points to not

Answer 36

• • Not all STRs are “simple” motifs that perfectly repeat a tetranucleotide motif.
• • SGM+ is now being replaced with DNA-17
• • Amelogenin is NOT an STR; its is a length polymorphism and used in sex determination.
• • PCR products are small in size and products from different loci overlap – hence the need for a fluorescent label.
• • The more alleles at each locus the better discrimination providing allele frequencies are approximately equal.

Question 37

characteristics of alleles observed in the SGM plus loci

Answer 37

look on ppt

Question 38

replication slippage

Answer 38

look on ppt

Top = normal replication. Template strand is black new strand is white. Blocks represent repeats in an STR
Middle = nascent (new) DNA loops put and number of repeats will increase
Bottom = template DNA loops out and number of repeats will decrease.

Question 39

The genomic context of STRs – what they “really” look like and how it relates to gene structure

Answer 39

• Look at some real STRs and their genomic environment

* Help understand both STRs and gene structure and gene expression

Question 40

both gene structure and expression

Answer 40

look on ppt