QUIZ 1

Question 1

A slash (/) separates genes and their alleles that are on…

Answer 1

homologous chromosomes

Question 2

A semicolon (;) separates genes and their alleles that are on…

Answer 2

non-homologous chromosomes

Question 3

A diploid organism is homozygous for 3 genes and heterozygous for 6 genes. All 9 genes are on diff chromosomes. How many different genotypes would you expect among the gametes produced by that organism? Put a number in the box

Answer 3

64

Question 4

A mother heterozygous for recessive mutant alleles of the a and B genes and a father homozygous for dominant alleles of the A and B genes have an offspring with genotype A/a/a; B/b. When did nondisjunction occur?

Answer 4

in the father at meiosis II

Question 5

From Question 5, the A/a/a;B/b offpsring is..

Answer 5

trisomic

Question 6

An embryo inherit t and B alleles from the sperm, and inherits T and b alleles from the oocyte. The T and B genes are on different chromosomes. correctly write the genotype of the embryo.

Answer 6

T/t; B/b

Question 7

Using the letter A for one gene and the letter B for the second gene, write the genotypes (using ; and / symbols) of a cross between a dihybrid and a fully recessive individual. Is this a test cross?

Answer 7

true

Question 8

Using the letter A for one gene and the letter B for the second gene, write the genotypes (using ; and / symbols) of a cross between a dihybrid and a fully recessive individual. What proportion of the offspring of the above cross do you expect to show the fully recessive phenotype?

Answer 8

1/4

Question 9

The sequence below shows the coding sequence of a gene that encodes a small protein

ATGCACTCCGGATACCATGATTTTGGATAA

How many amino acids are in the small protein encoded by this gene? Enter a number in the box provided.

Answer 9

9 (TAA is a STOP codon)