Mutational Mechanisms And Disease

Question 0

What effect do mutations in the coding region have on the protein and what classes of ‘altered function’ would be produced?

Answer 0

Coding region mutations lead to abnormal proteins. These result in:
Loss of function
Gain of function
Novel properties

Question 1

Name the four types of mutations that alter the ‘function’ of a protein.

Answer 1

Loss of function mutations
Gain of function mutations
Novel property mutations
Altered expression mutations

Question 2

What is the difference between gain of function and novel property mutations?

Answer 2

Gain of function refers to an increase in the efficiency of the protein doing what it normally does, through greater numbers or better processing.
Novel property refers to an entirely new function of the protein.

Question 3

What effects would mutations affecting gene regulation or dosage have and what classes of ‘altered function’ would be produced?

Answer 3

Gene regulation and dosage mutations lead to normal proteins produced in abnormal amounts.   These would produce:
Loss of function (decreased expression)
Gain of function (increased expression)
Altered expression (ectopic or heterochromic expression, inappropriate expression)

Question 4

What are the most common types and causes of known mutations?

Answer 4

Most known mutations affect the function of a protein, and Loss of Function is the most common type. Caused by deletions, insertions, or missense/nonsense mutations that eliminate or reduce the functionality of the protein. Includes entire gene deletions.

Question 5

What causes Duchenne Muscular Dystrophy, what are its clinical signs, and what other disease is it related to?

Answer 5

Large (multiple exon) deletions & Frame shift/nonsense mutations
Signs: X-linked trait. DMD Xp21.2
Calf pseudohypertrophy
Gower maneuver
Boys age 3-5, progressing to respiratory trouble and death ~18 yo
In frame deletions lead to milder Becker syndrome

Question 6

What causes alpha-thalassemia?

Answer 6

Deletion of the alpha globin gene(s).

Question 7

What sort of test may diagnose Duchenne Muscular Dystrophy, and differentiate it from Becker Muscular Dystrophy?

Answer 7

Protein gel electrophoresis (protein electrophoresis)
Duschenne will not produce any measurable protein
Becker will produce slightly smaller protein (shows lower than marker on the gel)

Question 8

What causes hereditary neuropathy with liability to pressure palsies, what are its clinical signs, and with what other disease does it share a gene?

Answer 8

Deletion of a copy of the PMP22 gene (del17p12). Autosomal Dominant trait
Signs: repeated focal pressure neuropathies, first attack in 2nd-3rd decade of life, recovery is often complete though slow (week/months)
Duplication of the PMP22 gene leads to Charcot-Marie-Tooth disease

Question 9

What mechanism leads to loss or duplication of the PMP22 gene?

Answer 9

Unequal crossing over between two highly homologous repeats on the chromosome (17p12). Daughter strands would have 2 copies and zero copies, respectively.

Question 10

Define ‘allelic disorders’.

Answer 10

Conditions that are genetically related, often due to the same gene.
HNPP and CMT are allelic disorders.

Question 11

What is the etiology of Osteogenesis Imperfecta Type I?

Answer 11

Loss of Function, Autosomal Dominant
Signs: brittle bones (break with diaper change), blue sclerae (eye whites), normal stature, gradual hearing loss.
Due to collagen deficiency
Type 1 Procollagen comprised of 2 proA1 chains and 1 proA2 chain
Loss of 1 proA1 gene (frame shift, nonsense, del) -> 50% norm proA1

Question 12

What is the etiology and consequence of Hemoglobin Kempsey?

Answer 12

Gain of Function, 
Missense mutation (Asp99Asn) in beta hemoglobin
Mutation causes higher O2 affinity in hemoglobin b/c it remains in relaxed state = gain of function (stronger binding)
Results in less O2 delivery to tissue, stimulating RBC creation leading to polycythemia

Question 13

What causes Charcot-Marie-Tooth disease, what are its clinical signs, and what is its allelic counterpart?

Answer 13

CMT caused by duplication of the PMP22 gene, Autosomal Dominant
Gain of Function mutation. dup17p12
Signs:
Hammer toes, high arches
Weakness of lower extremities, muscle atrophy, mild sensory loss
Allelic disorder: HNPP caused by deletion of PMP22 del17p12

Question 14

What type of functional disorder does sickle cell anemia represent?

Answer 14

Novel property mutation

Allows for polymerization of hemoglobin molecules

Question 15

What type of mutation disorder is represented by Osteogenesis Imperfecta Types II, III, IV?

Answer 15

Novel property mutation.

Caused by mutation that results in ‘bent’ proA2 fiber. Normal quantities of collagen produced, but 50% is defective.

Question 16

What type of mutation disorder is represented by hereditary persistence of fetal hemoglobin?

Answer 16

Altered expression mutation
Or Ectopic expression - expressed in wrong location
Heterochronic expression - expressed at wrong time

Question 17

What causes tri/tetra nucleotide repeat disorders and what do they result in?

Answer 17

AKA unstable repeat disorders
Caused by mistakes in replication of extensive and repetitive sequences. CAGCAGCAGCAGCAGCAGCAG etc.
Largely neuro degenerative disorders

Question 18

How are Fragile X Syndrome and Fragile X tremor and ataxia related?

Answer 18

Both are caused by tri nucleotide repeats in the 5’UTR.
~60 to 200 repeats causes tremor and ataxia through Gain of Function
>200 repeats causes Fragile X syndrome through Loss of Function

Question 19

What sort of disorder is Friedreich ataxia and where is its locus?

Answer 19

Tri nucleotide repeat disorder
>200 GAA repeats inside an intron
Loss of Function mutation

Question 20

What sort of disorder is Myotonic dystrophy 2 and where is its locus?

Answer 20

Tetra nucleotide repeat disorder
>75 TTCG repeats inside an intron
Novel Property (in the RNA) mutation

Question 21

What sort of disorder is Huntington’s disease and where is its locus?

Answer 21

Tri nucleotide repeat disorder
>40 CAG repeats inside an exon (40+ repeats = 100% incidence)
Novel property disorder (causes protein:protein interactions that result in a loos of function disorder in transcription factors)

Question 22

What sort of disease is Myotonic dystrophy 1 and where is its locus?

Answer 22

Tri nucleotide repeat disorder
>50 CTG repeats in the 3’UTR
Novel property (in the RNA) mutation

Question 23

In Huntington’s disease:
At what number of repeats does the sequence become unstable?
How does the number of repeats correlate to disease incidence?
In whose germ line does the expansion occur?

Answer 23

> 27 CAG repeats become unstable
Penetrance is roughly increased with increased # of repeats
40 repeats = 100% penetrance
Expansion occurs in the paternal germ line

Question 24

How does myotonic dystrophy demonstrate genetic anticipation?

Answer 24

The gradual appearance of the disorder phenotype over a few generations. Grandmother is symptom free, mother has mild disorder, son has severe disorder. Gradual increase in penetrance.