Molecular Genetics

Question 1

Outline significant scientific contributions/discoveries that led to our understanding of the structure and function of the DNA molecule made by Hershey and Chase.

Answer 1

Hershey and Chase used bacterial viruses called bacteriophage (viruses that destroy bacteria) in 1952. These bacterial viruses consist of a DNA core surrounded by a protein coat. The virus infects the bacterial cell by injecting its DNA into the host cell. The DNA’s mix and when enough parts are produced, the host cell ruptures, releasing more virus particles to infect more cells. They wanted to confirm it was the DNA, not the protein coat that were transferring the host cells. They knew proteins contained sulphur and DNA contained phosphorus. They injected the protein and DNA with radioactively labeled sulphur and phosphorus respectively, wanting to see which element ended up in the DNA of the host. The result showed that phosphorus ended up on the inside of the host, meaning that the DNA was responsible for directing genetic activity.

Question 2

Outline significant scientific contributions/discoveries that led to our understanding of the structure and fuction of the DNA molecule made by Griffith

Answer 2

At first scientists thought that proteins were the controlling factor in the cell (that coded for everything in the body) as it was more complicated in structure. However in 1928 Griffith used different bacteria strains that caused pneumonia in an experiment. He injected four mice with virulent, avirulent, heat-treated virulent, and live avirulent with heat-treated virulent bacteria respectively. The first mouse died, and the second and third mice lived as expected. But the fourth mouse died even though it was injected with avirulent bacteria and heat-treated (killed) virulent bacteria. This led Griffith to believe in some sort of transformation factor but he didn’t know what caused it yet.

Question 3

Outline significant scientific contributions/discoveries that led to our understanding of the structure and fuction of the DNA molecule made by Avery/McCarty/MacLeod

Answer 3

In 1944, Avery, McCarty and Macleod extracted one of three chemical components - RNA, proteins, or DNA - from the heat-killed virulent bacteria strains and mixed it with the avirulent strain. They injected mice with each new mixture. The first mixture had the proteins removed with protease but the mouse died. The second had the RNA removed with RNase but the mouse also died. The third had the DNA removed with DNase and the mouse lived. Thus they concluded that DNA is the source of genetic information.

Question 4

Outline significant scientific contributions/discoveries that led to our understanding of the structure and fuction of the DNA molecule made by Watson and Crick.

Answer 4

Watson and Crick used the previous work of others to conclude that DNA was a linear molecule with a sugar phosphate backbone and four nitrogenous bases dangling off the side. They knew from Chargaff’s experiment that the concentration of thymine equals adenine and cytosine’s concentration equals guanine. They also knew from Franklin’s experiments that DNA has two strands connected in a double helix with two chains of nucleotides oriented in the opposite direction.

Question 5

Outline significant scientific contributions/discoveries that led to our understanding of the structure and fuction of the DNA molecule made by Rosalind Franklin

Answer 5

Rosalind Franklin and Maurice Wilkins used x-ray diffraction to determine the overall shape of the DNA molecule. She concluded that DNA’s shape is highly regular and uniform with a helix shape, but it wasn’t the final model.

Question 6

Outline significant scientific contributions/discoveries that led to our understanding of the structure and fuction of the DNA molecule made by Chargaff

Answer 6

Erwin Chargaff performed experiments on DNA samples and found that samples had four nitrogenous bases, adenine, thymine, cytosine, and guanine. He later found that the amount of adenine = thymine and the amount of cytosine = guanine. He hypothesized the connection between the base pairs, called Chargaff’s Rule.

Question 7

Describe the structure of DNA.

Answer 7

DNA has fundamental units called nucleotides. Each nucleotide has 3 parts: a 5-carbon deoxyribose sugar, a phosphate group, and one of four nitrogenous bases: adenine, thymine, cytosine, and guanine. The DNA molecule is composed of two nucleotide chains lined up in opposite directions (anti-parallel). The 2-sugar phosphate backbones are on the outside while the bases face inwards and connect in the middle by hydrogen bonds. It is in a double-helix shape and there is a 3’ end and a 5’ end, based on the numbers on the carbons that the phosphate group attaches to.

Question 8

DRAW the structure of DNA.

Answer 8

Link to DNA structure: https://www.google.ca/search?q=dna+structure&newwindow=1&source=lnms&tbm=isch&sa=X&ved=0ahUKEwiI3b6Z5sDUAhUo74MKHZCyDuQQ_AUICigB&biw=1440&bih=741#newwindow=1&tbm=isch&q=dna+nucleotides&imgrc=UAcSQLBLglxxUM:

Question 9

Describe the process of DNA respication from start to finish.

Answer 9

The process of DNA replication starts with helicase, an enzyme that actually splits the DNA into 2 strands, creating a replication fork or bubble. The enzyme gyrase also helps to make sure the strands do not supercoil. Then on both strands binding proteins come in to ensure that the two strands are stabilized after being split. Now on the 3’ to 5’ parent strand there is a new daughter strand being synthesized in the 5’ to 3’ direction (since DNA strands are antiparallel). Polymerase III is responsible for synthesizing this new strand on the leading strand, called continuous synthesis. It places nucleotides into position, creating a new strand in the 5’ to 3’ direction. Now on the lagging strand there is discontinuous synthesis occurring. On the lagging strand the enzyme primase creates RNA primers and places them ahead of the polymerase III. This then allows the polymerase II to go back and synthesize nucleotides in the 5’ to 3’ direction, but in these small sections, filling in the gaps called Okazaki fragments. Then polymerase I comes along and joins the Okazaki fragments together, and the two DNA strands lock, now with two sets precisely replicated. Also, polymerase II comes and acts as a proofreader that checks to ensure that the genetic code has been correctly replicated and filled in. This is semi-conservative replication because the strands are split and information is copied from an old strand on each side. This allows replication to be extremely precise as it is based on the code (complementary base pairings) of the old strand.

Question 10

Compare DNA and RNA in terms of their structure, use locations in the cell.

Answer 10

DNA is made up of nucleotides which contain a 5 carbon deoxyribose sugar, a phosphate backbone and a nitrogenous base (A, C, T, G). DNA contains the genetic code for all cells in the body and is located in the nucleus of the cell. RNA is made of nucleotides which contain a 5-carbon ribose sugar, a phosphate backbone, and a nitrogenous base (A, C, U, G). RNA transfers the code for creation of polypeptide chains and amino acids, and eventually proteins which create recognizable traits. RNA helps carry out DNA’s blueprint guidelines, and is located first in the nucleus, and then transferred to the cytoplasm.

Question 11

Outline the steps involved in protein synthesis

Answer 11

Protein synthesis starts with transcription. First there is initiation, where enzymes unwind and separate the DNA. Then elongation occurs where RNA nucleotides pair with complementary nucleotides on one DNA strand. RNA polymerase joins the RNA nucleotides together and an immature mRNA strand is formed and in termination that immature mRNA nucleotide is released. Then there are post-transcriptional modifications where the immature mRNA goes through three modifications to become functional. First splicing: Introns (stretches of mRNA that do not appear in the final mRNA) are removed and exons (stretches of mRNA that do appear and are expressed to find proteins) are spliced together by the enzyme spliceosome. Then capping, where a 5’ cap is added to the 5’ end of the RNA. Finally tailing, where a poly-A-tail is added to the 3’ end of the mRNA. After transcription the two original DNA strands rejoin. Transcription occurs in the nucleus and the new mRNA take the genetic info to the rRNA in the cytoplasm. Finally transcription occurs. It occurs in the cytoplasm where the ribosome is found. It’s in the cytoplasm where the mRNA acts as a template and guides the synthesis of a chain of amino acids that form a protein, which vary based on the genetic code. There is initiation where mRNA moves into rRNA (a ribosome). A tRNA molecule carrying the amino acids methionine binds to the start codon, AUG, on the mRNA. Then elongation occurs, where the polypeptide chain grows as more tRNA’s bring more amino acids together as dictated by the codons on the mRNA. Termination is when a stop codon (UAA, UAG, UGA) on the mRNA is reached. The ribosome disassembles and releases the mRNA. The polypeptide is also released to undergo further modification to become a functional protein.

Question 12

What amino acids are coded for by the following DNA strands? DNA: GCTTCCTACGCTGGAACCGCGCGATTCATCGCT

Answer 12

Amino Acids: methionine (start), arginine, proline, tryptophan, arginine, alanine, lysine, stop

Question 13

Explain the following gene mutations: frame shift

Answer 13

Frameshift mutations occurs when a number of nucleotides are inserted into or deleted from a DNA sequence. If the number deleted is not a multiple of 3 the codon groupings will change. This results in a reading error that will code for different amino acids. It is the most damaging type of gene mutation.

Question 14

Explain the following gene mutations: dimer formation

Answer 14

UV light causes damage when cytosine or thymine absorbs it. If the base beside is the same a covalent double bond is formed, causing a kink and DNA polymerase can’t read the dimer and mispairing occur.

Question 15

Explain the following gene mutations: point mutation (silent, missense, nonsense)

Answer 15

When one base is substituted for another in the DNA code. This type of mutation results in little or no change in amino acids. There are three types: Silent mutation: the changed base doesn’t change the amino acid. Missense mutation: the changed base does change the amino acid. Nonsense mutation: the changed base now codes for a stop codon.

Question 16

List some of the positive and negative spects of gene mulations.

Answer 16

Gene mutations would only be considered positive if it gave an organism an advantage in the environment. The negatives can include onset of cancer, and negatively effects the organisms.

Question 17

Provide some examples of mutagens.

Answer 17

ionizing radiation, viruses and microorganisms, alcohol and dietary components, and environmental poisons and irritants

Question 18

Explain how restriction enzymes allow scientists to create recombinant DNA. Provide two examples of how scientist have used recombinant DNA technology.

Answer 18

Restriction enzymes allow genetic engineers to cut DNA in a controlled way Once the recombinant DNA is created if is used in transgenic organisms, gene farming, and for producing human insulin, and for producing GM foods.

Question 19

Explain how a bacterial cell can modify their own DNAthrough conjugation. How may this be useful to scientists? Be detailed in your description of the process.

Answer 19

Plasmids have mall accessory chromosomes called plasmids, some conjugative plasmids can be exhchanged with other bacteria though conjugation. Via this process they can process antibiotic resistance to other bacteria. This can be useful to scientists as it helps explain why groups have antibiotic resistance and other traits.

Question 20

Define sticky end

Answer 20

Sticky ends are overhanging single stranded of DNA after restriction enzymes cut though, they may only be joined to other sticky ends with complimentary base sequences.

Question 21

Define blunt end

Answer 21

Blunt ends are when there is no overhang after the restriction enzyme cuts though. It can be joined to any other blunt end fragment but tends to be non-specific.

Question 22

Define annealing

Answer 22

Annealing is when tow matching “sticky ends” come together. They join by base pairing. This process is called annealing, they join by attraction.

Question 23

Define ligation

Answer 23

Ligation is when DNA fragments produced using restriction enzymes may be reassembled. Pieces of DNA are joined together using an enzyme called DNA ligase. DNA of different origins produced in this way is called recombinant DNA that has been combined from different sources.

Question 24

Be prepared to briefly explain the following types of biotechnology and provide an example of each: Bacterial Transformation

Answer 24

Bacterial Transformation:
One of 3 processes by which outside genetic material may be introduced into a bacterial cell. The DNA is cut using restriction enzymes and pasted in by ligation. ex. producing human insulin.

Question 25

Be prepared to briefly explain the following types of biotechnology and provide an example of each Recombinant DNA

Answer 25

Recombinant DNA:
is DNA molecules formed by laboratory methods of genetic recombination to create sequences that wouldn’t otherwise be found. Used in medicine and research, is also why we have human insulin.

Question 26

Be prepared to briefly explain the following types of biotechnology and provide an example of each: Transgenic Organisms

Answer 26

Transgenic organsims:
are produced with the introduction of foreign DNA into its genome, providing it with a new phenotype (i.e. characteristics). We use this in insulin, vaccines, and in our crops.

Question 27

Be prepared to briefly explain the following types of biotechnology and provide an example of each: Genetically modified organisms.

Answer 27

GMO’s:
are any organisms that has had it’s genetic material attend using genetic engineering teqniques. This is used in medicine, GM foods, GM crops, and in “GLOfish” pets.

Question 28

Be prepared to briefly explain the following types of biotechnology and provide an example of each: Transgenic Bacteria

Answer 28

Transgenic Bacteria:
are organisms that have had a foreign gene inserted into them, making them transgenic. It’s grown in large vats where a specific gene is inserted to give it an advantage. This includes Insulin, vaccines, artificial sweeteners, and human growth hormones.

Question 29

Be prepared to briefly explain the following types of biotechnology and provide an example of each: Bioremediation.

Answer 29

Bioremediation:
is a waste management technique that involves the use of organisms to remove or neutralize pollutants from a contaminated site. Used for oil spill clean up, crime scene clean up, contaminated soil clean up.

Question 30

Be prepared to briefly explain the following types of biotechnology and provide an example of each: Transgenic Plants.

Answer 30

Transgenic Plants:
are genetically engineered plants using a breeding approach that uses recombinant DNA techniques to create plants with new characteristics. Done to make plants as useful and productive as possible.

Question 31

Be prepared to briefly explain the following types of biotechnology and provide an example of each: Gene Pharming.

Answer 31

Gene Pharming:
Is a technology that uses genetic engineering to insert genes that code for useful pharmaceuticals into host animals or plants that wouldn’t otherwise express those genes, thus created a GMO. Planted into animals as proteins into DNA and harvested from milk, eggs, and blood.

Question 32

Be prepared to briefly explain the following types of biotechnology and provide an example of each: Saviour Siblings

Answer 32

Saviour Siblings:
kids born with the specific purpose of providing a cell or organ transplant to a sibling affected by a fatal disease. They are conceived via vitafertalization. fertilized eggs are tested for compatibility and if they are compatible, they get implanted. Very controversial

Question 33

Be prepared to briefly explain the following types of biotechnology and provide an example of each: Human Genome Project

Answer 33

Human Genome Project:
is an international scientific research project with the goal of determining the sequences and map all the gens in the human body- together know as a genome.

Question 34

Explain what a karyotype is. Which chromosomes indicate gender? List the various disorders that can result from having multiple X chromosomes.

Answer 34

A Karyotype is a photograph of all the homologous chromosome in a cell. The X and Y chromosome indicates gender (XX, and XY). They display chromosome contents of a cell according to number, size, and type, 22 autosomes, 1 pair of sex chromosomes, (extra x = Klinefelters)

Question 35

Explain the various ways that a fetus can be tested for a chromosome mutation.

Answer 35

A fetus can be tested for a chromosome mutation in 3 ways

Amniocentesis: benefits include diagnosis of chromosome abnormalities and diagnosis of other defects, risks include discomfort, infection, and miscarriage.

Chorionic villus sampling: Benefits include diagnosis of chromosome abnormality, diagnosis of a certain genetic defect. Risk includes miscarriage, infection, and newborn limb defects.

Fetal blood sampling: benefits include diagnostics of abnormality, checks blood problems, medications can be given before birth, risks include bleeding, infection, amniotic fluid leak, death of fetus.

Question 36

State some of the ethical issues that may arise as a result of genetic testing for inherited conditions or disorders (such as downs syndrome)

Answer 36

Genetic testing for inherited conditions or disorders may lead to ethical issues because many fear we are playing God by deciding what conditions or disorders our children are born with good or bad. Naturally they conclude that this could lead to humans eventually choosing more than just to eliminate bad traits from their offspring, but eventually having designer babies through PGD, gene therapy, or cloning will be possible or literally designing your baby like a product is unethical. Creating a perfect race free of imperfection is a possibility this could lead to and raises many questions about the value of human life and and without disorders.

Question 37

Explain how chromosome mutations may arise during meiosis through non-disjuction. State some of the various chromosome mutations that may occur.

Answer 37

Chromosome mutations happen most frequently during the crossing over stage of meiosis. Most of these chromosomal mutations result from non-disjunction. That is where the spindle fibres fail to separate during meiosis resulting in gametes lacking a chromosome. Some of the various chromosomal mutations that may occur include Down’s syndrome, Turner’s syndrome, and Klinefelter’s syndrome.

Question 38

Any mistake or change in the DNA sequence is known as a mutation. Discuss the types of mutations that can occur in a cell to alter is DNA. Be sure to explain which mutations are most dangerous to a species and why. Also, explain why low level mutations, such as those that occur spontaneously, may be advantageous to a species. Please include examples of mutations we have discussed in class in your explanation to add clarity to your answer.

Answer 38

In a cell, there are many types of mutations that can occur in a cell to alter its DNA. There are gene mutations which include point mutations (silent, missense, and nonsense) and frameshift mutations which can alter an entire DNA sequence and cause major damage. An example of a point mutation is cystic fibrosis, involving the deletion of a codon resulting in the deletion of an amino acid. There are also dimer formation mutations with UV light causing a kink in our DNA strand and misreading. There are also chromosomal mutations happening during meiosis and the “crossing-over” stage. There are 5 main types of mutations there: 1) translocation (transfer), ex. chronic myelogenous leukemia with chromosomes 9 and 22 swapping. 2) Inversion (flipped orientation), 3) Deletion, 4) Duplication, 5) Non–disjunction (the most common). ex. Down’s syndrome, Turner’s syndrome, and Klinefelter’s syndrome. There are trisomy and monosomy mutations. These are just some of the mutations that occur. However the most dangerous mutations to a species are frameshift mutations because they cause a reading error during translation… the codons, amino acids, and proteins will change, literally changing the entire genetic makeup of the organism to a species because some of these may be used by natural selection to increase a species’ chance of survival and reproduction, like camouflage or size change. that is how evolution occurs, because low-level mutations occur all the time and the advantageous ones survive and eventually take hold in a population.

Question 39

Explain the process of gel electrophoresis in general terms.

Answer 39

Gel electrophoresis is used to separate strands of DNA according to size and charge. The electrophoresis separates different gene lengths. DNA samples are placed in wells and covered with a buffer solution. An electric field is applied to the chamber pushing the molecules of DNA through the gel depending on their charge. Negatively charged phosphates in DNA cause the DNA to move away from the negative terminal and through the gel towards the positive terminal. As the molecules move through the gel longer strands of DNA get stuck early on while short strands move further through the gel. This can be seen by using a dye. The Molecular Weight Ruler acts as a guide to determining the number of base pairs per sample in each well.

Question 40

Provide examples of the various applications of Gel Electrophoresis in the real world.

Answer 40

Gel electrophoresis is used in DNA fingerprinting and DNA profiling by showing variations in DNA. DNA fingerprinting with gel electrophoresis can be used for paternity testing, forensic science, looking for genetic diseases (cystic fibrosis), checking the genetic relatedness of different organisms (checking that captive endangered species aren’t inbred, etc.) It sorts variation in gene length.

Question 41

Be able to explain how error may have been introduced in your lab.

Answer 41

Error may have occurred in the GMO lab through a few ways. Perhaps the pipette tips have may been contaminated with other DNA from the air or other surfaces, and we may have left our lids on our samples open for too long, allowing air to get in and contaminate our DNA. We may not have mixed our DNA well enough when extracting it from the test food and that may have contributed to our error. We also dropped our samples (closed) and had to re-centrifuge them, and then we didn’t close one of our lids enough and it broke in the centrifuge, forcing us to use another group’s test control which may have also contributed to our error, and perhaps our measurements could’ve been done more carefully and precisely. All these things contributed to error in our GMO lab.

Question 42

Be able to identify banding patterns on a gel and predict the number of base pairs by using a molecular weight ruler. How many base pairs are in the bands in lanes 1,3 and 4.

Answer 42

To read banding patterns on a gel, compare and match readings to the Molecular Weight Ruler. Lane 1 - 500 bp; Lane 3 - 500 bp; Lane 4 - 200 bp

Question 43

Which suspects DNA was found at the crime scene (see charts)

Answer 43

Crime Scene 1 - Jane 1; Crime Scene 2: Jane 2

Question 44

What factors influence the movement of DNA through the gel? How does this impact the banding patterns that you will see?

Answer 44

The size and the length of the strands of DNA influence the movement of DNA through the gel. The DNA strands are attached used positively charged fields to pull the negatively charged DNA through the gel towards it. Longer and larger strands will get stuck earlier in the gel, while shorter strands more further in the gel. This allows us to determine the length and the base pairs in the bands. This means that the further down in the gel a band is, the less base pairs it will contain.

Question 45

Down Syndrome:

Answer 45

Down Syndrome:
An additional chromosome # 21. due to non-disjectiion in meiosis. Will have cognitive impairment, distinct facial features and growth impairment.

Question 46

Turners Syndrome:

Answer 46

All or part of an ‘X’ chromosomes is missing affected 1/2500 girls Result in short heigh, bod chest, low hairline, lowest ears, webbed neck, some cognitive impairment.

Question 47

Klinefelter Syndrome:

Answer 47

An additional X chromosome in males resulting in ‘XXY’. Results in female like characteristics like absent frontal baldness, female hair growth patters, long leg and arms, narrow shoulders, wide hips, great developments, and underdevelopment in reproductive organs.