Midterm #1

Question 1

What are the 5 most common elements in the human body? What are the percentages (approximately)

Answer 1

Carbon (18.5%), oxygen (65%), hydrogen (9.5%), nitrogen (3.4%) , calcium (1.5%)

Question 2

What are ions? Give an example

Answer 2

an atom or molecule with a net electrical charge; e.g. Na+, Cl-

Question 3

What does it mean for a molecule to be polar? Give an example of a polar molecule in the body.

Answer 3

Polar = separation of electric charges, the electrons are shared unequally between atoms making one
more negative and the other more positive but overall the molecule will still have a neutral charge.
Water is a polar molecule.

Question 4

What do we mean by hydrophobic and hydrophilic substances?

Answer 4

Water, a polar molecule, dissolves (or loves to hang out with) other things that have polarity or charge.
We call things that like to hang out with water hydrophilic (Greek hydro =water, philos = loving).
Hydrophilic substances like to be around water, and water likes to be around them. Substances such as
hydrocarbons that don’t dissolve in water—that don’t like to hang out with water—are called
hydrophobic (Greek phobos = fearing).

Question 5

Describe the 4 major macromolecules and their functions in cells (neurons)

Answer 5

Carbohydrates
●Sugars and starches; made from carbon, hydrogen & oxygen
●Energy source/storage; brain’s main energy source is glucose
Lipids
●carbon, hydrogen, (oxygen)
●In neurons: (phospho)lipids make up cell membranes
Proteins / amino acids (draw an amino acid, and the 4 levels of protein structure)
●Proteins = chains of amino acids (polypeptides) linked by peptide bonds
●
●In neurons: ion channels or receptors (in the cell membrane); some neurotransmitters are proteins/amino acids
Nucleic acids
●DNA, RNA
●Composed of nucleotides: adenosine, cytosine, thymine, guanine (for DNA)
●Carry genetic info; important for regulatory functions and catalysis

Question 6

Describe the components of phospholipids. How are they integral to cell structure?

Answer 6

Phospholipids are made up of a hydrophilic head and hydrophobic tails, In the cell, they form the
phospholipid bilayer by having the hydrophobic tails cluster together inside while the hydrophobic heads stick
outside into solution and can interact with “water loving” molecules. The tails will interact with
nonpolar/non-water loving molecules.

Question 7

Describe the “Blender Experiment” and its conclusion(s)

Answer 7

Radioactivity was just discovered by Marie Curie-Sklodowska. Chase and Hershey decided to make
radioactive DNA and protein in bacteriophages and track it in bacteria. They did this by growing the bacteriophages on plates with either radioactive phosphorus or sulfur. DNA does not have sulfur but has phosphorus while protein has sulfur but not phosphorus. Next, they mixed the bacteriophages from either S or P plate with bacteria, placed the mixture in a blender to separate and spin down in a centrifuge. By spinning the mixture down, bacteria will separate into the pellet at the bottom (b/c they’re heavier) while the
bacteriophages will separate into the supernatant at the top. They saw that the radioactive protein was found in the supernatant while the radioactive DNA was found in the pellet hence concluding DNA is the genetic
material.

Question 8

What were the contributions of each scientist & group of scientists below to our understanding of
genetics?

Answer 8

Gregor Mendel demonstrated that different traits segregate and sort in an orderly fashion during reproduction
Max Delbruck hypothesized that genes were likely to be large molecules
Oswald Avery described experiments with pneumococcal bacteria demonstrating that DNA can carry genetic information from one cell to another
Francis Crick, Rosalind Franklin and James Watson discovered the structure of DNA and hypothesized a method of it’s replication

Question 9

Why is DNA important? What is the structure of DNA?

Answer 9

DNA carries genetic information, it is what we are and living forms are made up of. DNA is a double helix

Question 10

What is the complimentary stand to the following DNA strand? ATGCCACATAGAGGTGCAATTTCTTAA

Answer 10

TACGGTGTATCTCCACGTTAAAGAATT

Question 11

What is the difference between transcription and translation?

Answer 11

The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to produce proteins is called translation.

Question 12

What do we mean by diffusion? What is the effect of temperature on diffusion?

Answer 12

Particles in the solution are constantly moving as a result of the energy of thermal agitation. The
movement is random and tends to cause particles to move apart and distribute uniformly over
whatever volume of fluid is available, a process called diffusion. Diffusion is directly
proportional to a rise in temperature.

Question 13

What are channel proteins and carrier proteins?

Answer 13

• Channel protein is a special arrangement of amino acids which embeds in the cell
  membrane, providing a hydrophilic passageway for water and small, polar ions. Like all transport proteins, each channel protein has a size and shape which excludes all but the most specific molecules.
• Carrier proteins bind specific solutes and transfer them across the lipid bilayer by undergoing conformational changes that expose the solute-binding site sequentially on
  one side of the membrane and then on the other

Question 14

What is the difference between voltage-gated ion channels and sodium/potassium pumps?

Answer 14

Sodium/potassium pumps: active transporter, needs energy in the form of ATP to pump 3
sodium ions out of the cell and 2 potassium ions into the cell
Voltage-gated ion channels: Passive transporter, does not require any energy for the ions to move through it. The ions use their concentration gradient to move around

Question 15

If a neuron were to be missing sodium/potassium pumps, what would happen to the resting membrane potential of the neuron?

Answer 15

If the pump stops for a long time, the membrane potential goes to zero. That would also abolish
action potentials and the flow of information among neurons

Question 16

Describe the stages of action potential generation:

Answer 16

1. Resting potential
2. Threshold of excitation
3. Peak of potential
4. Repolarization
5. Hyperpolarization

Question 17

Identify each component of synaptic signaling:

Question 18

Glutamate/Glutamic Acid

Answer 18

Primary excitatory neurotransmitter

Question 19

Acetylcholine

Answer 19

first neurotransmitter discovered by Otto Loewi (+vagusstoff) & NT between nerve and muscle

Question 20

GABA

Answer 20

Primary inhibitory transmitter in the brain

Question 21

IPSP

Answer 21

The cell is hyperpolarized

Question 22

EPSP

Answer 22

The cell is depolarized

Question 23

What are GPCRs and to which group of receptors do they belong?

Answer 23

GPCRs are G-protein coupled receptors that sit in the membrane and bind neurotransmitters such
as serotonin, acetylcholine and dopamine. They are metabotropic receptors.

Question 24

Whats the difference between ionotropic receptors and metabotropic receptors?

Answer 24

Ionotropic Receptors:
- effects are rapid but short lived
- NT causes opening of the channel
- Modify the post-synaptic potential (EPSPs or IPSPs)
Metabotropic Receptors:
- Effects are slower but longer lasting
- NT can cause opening or closing of channels (or other things like transcription)
- In addition to changing the post-synaptic potential they modulate many neural functions
- 2nd messengers can diffuse throughout the cell, affecting different neuronal regions

Question 25

What happens when a neurotransmitter binds a GPCR?

Answer 25

G-protein coupled receptors sit in the membrane and are bound by a G-protein. When there are no neurotransmitters, this G-protein is in GDP state and stays bound to GPCR. When a
neurotransmitter binds the GPCR, the G-protein will switch from GDP to GTP and this will allow the G-protein to bind an effector enzyme.

Question 26

explain the basic circuit diagram for the baroreceptor reflex

Answer 26

1. Blood pressure drops
2. Baroreceptor neurons decrease their firing rate
3. A sign inversion takes place in the medulla
4. Activity of sympathetic neurons increases
5. This drives an increase in cardiac activity and constriction of blood vessels
6. Blood pressures increases
7. This brings baroreceptor neurons firing rate back to the normal ‘set point’
8. This system comes back into equilibrium

Question 27

What do we mean by sympathomimetic, sympatholytic, parasympathomimetic and parasympatholytic?

Answer 27

Drugs/Molecules that have an activating effect on the sympathetic nervous system are called
sympathomimetic drugs. The converse is termed sympatholytic means to disrupt. Thus, sympatholytic
substances decrease the effects of the sympathetic nervous system on its target organs. There are
analogous terms that apply to effects on the parasympathetic nervous system—parasympathomimetic
and parasympatholytic substances act to increase or decrease, respectively.

Question 28

What is the primary function of the autonomic nervous system?

Answer 28

maintain homeostasis

Question 29

What are the three major subdivisions of the ANS?

Answer 29

the sympathetic nervous system(fight or flight),
the parasympathetic nervous system(rest and digest), and the enteric nervous system(controls
the gastrointestinal system).

Question 30

What do the parasympathetic and sympathetic nerves do in the heart?

Answer 30

PS: releases acetylcholine and decreases heart rate
S: releases norepinephrine and increases heart rate

Question 31

Where does brain dopamine circuitry originate?

Answer 31

The ventral tegmentum and the substantia nigra

Question 32

What happens when medication for epileptic seizures fail?

Answer 32

If this happens, patients often have devices planted on their cortex to find the locus of the seizure using a method called ECOG

Question 33

What is a seizure, what is it characterized by, and how would this present in an Electroencephalography
(EEG) recording?

Answer 33

Runaway neural activity in the brain, characterized by muscle convulsions/spasms, amnesia, and
loss of consciousness. In an EEG recording it presents as large waves

Question 34

How do you calculate Therapeutic Index?

Answer 34

Therapeutic Index= lethal dose/ therapeutic dose. A safer drug (harder to overdose) has a
higher TI.

Question 35

Describe the two primary means by which a molecule may pass the blood-brain barrier – and
give one example molecule of each category

Answer 35

1) One is via transporter proteins that shuttle specific molecules across the membranes
of the cells forming the blood vessel walls. Such a transporter exists for glucose, the primary energy currency used to move energy throughout the body. (Phosphate bonds,
especially ATP, are the primary energy currency inside of cells.) Other transporters are
known to move specific amino acids across the blood-brain barrier, and still others move other essential molecules.
2) The second way in which molecules may cross the blood-brain barrier is by dissolving right through the blood vessel cell walls. The cells that make up the blood vessel walls are bounded, like all cells, with phospholipid bilayer membrane. In order to dissolve into
and pass through a lipid bilayer membrane, a molecule must be sufficiently hydrophobic (lipophilic) to comfortably pass through the highly hydrophobic central core of the bilayer. Oxygen and other small gaseous molecules are able to do this. And pretty much all the known drug molecules that have impact on brain function cross the blood-brain barrier because they are lipophilic enough to dissolve right through the cells forming the
barrier

Question 36

What is tetrodotoxin, and what is its mechanism of action? How does it affect the brain?

Answer 36

TTX blocks voltage-gated sodium channels. This means that peripheral nerves are unable to generate normal action potentials.
Symptoms: numbness, muscle weakness, paralysis & death from respiratory paralysis. TTX does not get into the brain, so there are no CNS effects.

Question 37

What drugs/chemical compounds block/inhibit voltage-gated sodium channels?

Answer 37

Tetrodotoxin, Saxitoxin, Batrachotoxins, and Cocaine
–> The first four’s primary action is to block voltage-gated sodium channels while Cocaine’s primary goal is to act on monoamine neurotransmitter systems (e.g. dopamine), but
cocaine can also block Na+ channels (as is common for local anesthetics)

Question 38

What are the 5 most common psychoactive substances and their functions?

Answer 38

Tobacco: Agonizes nicotinic acetylcholine receptors
Alcohol: A sedative-hypnotic that acts on GABA receptors
Arecoline: 600 million people + Muscarinic GPCR agonist that is parasympathomimetic
Cannabis: Operates as a retrograde messenger
Caffeine: Adenosine antagonist