MCQ

Question 1

Transformation Experiment. In a bacterial transformation experiment the total
transformation mix volume was 1000 µl and contained 0.1µg of plasmid DNA. When
10µl aliquots of this mix were plated onto each of two nutrient agar antibiotic medium
plates and incubated at 37oC for 48 hours, 80 and 120 antibiotic resistant transformants
were obtained. What is the frequency of transformation per µg of plasmid DNA?

A. 4.0 x 106
transformants per µg
B. 1.0 x 106
transformants per µg
C. 4.0 x 105
transformants per µg
D. 1.0 x 105
transformants per µg
E. 1.0 x 104
transformants per µg.

Answer 1

D. 1.0 x 105

transformants per µg

Question 2

In a complementation test, what unit of genetic information is represented by a single
complementation group?

A. nucleotide
B. codon
C. operon
D. gene
E. genome.

Answer 2

D. gene

Question 3

Agarose gel electrophoresis. What are the three configurations in which bacterial
plasmid DNA can be most commonly observed?

A. open circle / linear / supercoiled
B. closed circle / linear / supercoiled
C. open circle / irregular / supercoiled
D. open circle / linear / superscript
E. closed circle / irregular / superscript

Answer 3

A. open circle / linear / supercoiled

Question 4

In the context of prokaryotic gene expression, which of the following is the most
appropriate definition of an operator?

A. a cluster of genes that are regulated by a single promotor
B. a DNA-binding protein that regulates gene expression
C. a non-coding regulatory DNA sequence that is bound by RNA polymerase
D. a non-coding regulatory DNA sequence that is bound by a repressor protein
E. a section of DNA transcribed but not translated.

Answer 4

D. a non-coding regulatory DNA sequence that is bound by a repressor protein

Question 5

In bacteria, what is the name for groups of genes that are involved in the same
metabolic pathway or functional characteristic, and are clustered together and under
the control of a single regulatory component?

A. genomic islands
B. cistrons
C. replicons
D. operons
E. telomeres

Answer 5

D. operons

Question 6

Within a eukaryote gene, exons are:

A. sequences that are transcribed and translated into a polypeptide
B. sequences not transcribed
C. sequences transcribed but not translated
D. sequences necessary for replication
E. sequences involved in gene regulation

Answer 6

A. sequences that are transcribed and translated into a polypeptide

Question 7

In female mammals, one X chromosome is largely inactivated. The inactivated X
chromosome has:

A. higher levels of acetylation of histone proteins
B. lower levels of acetylation of histone proteins
C. a lack of associated histone proteins
D. lower levels of DNA methylation
E. higher levels of DNA methylation

Answer 7

E. higher levels of DNA methylation.

Question 8

The promoter sequences of eukaryote genes:

A. are located immediately adjacent to the genes they regulate and are considered to be part of the genes
B. are located some distance downstream of the genes which they regulate
C. are located some distance upstream of the genes which they regulate
D. always contain a TATA box, but never contain a CAAT box
E. always contain a CAAT box, but never contain a TATA box.

Answer 8

A. are located immediately adjacent to the genes they regulate and are considered to be part of the genes

Question 9

Which of the following processes may be involved in the modification of nucleosome
histone proteins to either activate or repress eukaryote gene expression?

A. acetylation only
B. methylation only
C. acetylation and phosphorylation
D. methylation and phosphorylation
E. acetylation, methylation and phosphorylation.

Answer 9

E. acetylation, methylation and phosphorylation.

Question 10

Long noncoding RNAs (lncRNAs) may repress transcription in eukaryotes by:

A. forming a complex with proteins to affect heterochromatin methylation
B. recruting a cofactor to the promotor thus preventing the binding of transcription
factors
C. forming a triple helix with promotor DNA thus preventing the binding of
transcription factors
D. all of the above
E. none of the above since lncRNAs only function by activating genes.

Answer 10

D. all of the above

Question 11

Mutations can lead to:

A. malignancy or cancer
B. heritable defects
C. ageing
D. none of the above
E. all of the above.

Answer 11

E. all of the above.

Question 12

Apoptosis or programmed cell death occurs:

A. at single cell level
B. in a group of cells
C. either at a single cell level or in a group of cells
D. at tissue level
E. at the organ level.

Answer 12

A. at single cell level

Question 13

In the context of Ames mutagenicity test, ‘auxotrophs’ means organisms require:

A. no supply of one or more specific nutrients
B. additional supply of one or more specific nutrients
C. minimal supply of one or more specific nutrients
D. any of the above, but dependent on the specific test
E. none of the above.

Answer 13

B. additional supply of one or more specific nutrients

Question 14

The sensitivity of the Ames test could be enhanced by:

A. inducing additional mutations in DNA repair genes
B. inducing mutations in genes which could allow entry of larger molecules into the
cells
C. adding liver enzymes which could metabolise the chemicals
D. all of the above
E. none of the above.

Answer 14

D. all of the above

Question 15

The p53 gene is:

A. a tumour suppressor gene
B. known as “guardian of the genome”
C. mutated in approximately 60% of cancers
D. involved in a check point at the G1/S border
E. all of the above.

Answer 15

E. all of the above.

Question 16

Which of the following base analogues is required when cells are grown under in vitro
conditions for the analysis of sister chromatid exchanges (SCEs) for biomonitoring
purposes:

A. 5-bromodeoxyuridine (BrdU or BudR)
B. uridine
C. inosine
D. uridine and inosine
E. none of the above.

Answer 16

A. 5-bromodeoxyuridine (BrdU or BudR)

Question 17

For biomonitoring purposes, the fluorescent in situ hybridisation (FISH) technique is an
efficient method to analyse:

A. chromosomal aberrations and aneuploidy
B. mutations in specific genes
C. sister chromatid exchanges (SCEs)
D. DNA strand breaks
E. DNA adducts.

Answer 17

A. chromosomal aberrations and aneuploidy

Question 18

Polymerase Chain Reaction (PCR). Given that the temperature in degrees Celsius (t)
at which half the PCR primers in a reaction will bind to template DNA = 4(G+C) +
2(A+T), determine the optimal annealing temperature for use in a PCR for the two PCR
primers below:

Primer 1 : 5‘ GGATCGGCATGCCCTTATTAA ‘3
Primer 2 : 5’ TTGGTATTCCTTTCATGGGAG ‘3

A. 2 oC
B. 60 oC
C. 61 oC
D. 62 oC
E. 122 oC.

Answer 18

D. 62 oC

not sure though

Primer 1 60 degrees
Primer 2 62 degrees

Question 19

The genome of a cellular life form consists of its entire:

A. gene content
B. regulatory regions controlling gene expression
C. DNA sequences
D. cistronic information
E. RNA coding sequences.

Answer 19

C. DNA sequences

Question 20

In gene cloning experiments, one reason why bacteria are poor hosts for expressing
eukaryotic genes is their inability to:

A. post-translationally modify proteins
B. sexually reproduce
C. modify lipid metabolism
D. modify carbohydrate metabolism
E. modify nucleic acid metabolism.

Answer 20

A. post-transcriptionally modify proteins

Question 21

An animal or plant which has foreign gene(s) introduced into its genetic make-up and
passes on those genes to it’s offspring is known as:

A. transallelic
B. transformed
C. transmutable
D. transgenomic
E. transgenic

Answer 21

E. transgenic.

Question 22

Tautomerism: at what frequency do rare enol or imino forms of nucleotide bases occur
in living cells?
A. 1 in 106
B. 1 in 105
C. 1 in 104
D. 1 in 103
E. 1 in 102

Answer 22

E. 1 in 102

Question 23

In bacteria, large transposable, mobile genetic elements, which carry many genes are
known as:

A. genomic islands
B. recombinant islands
C. virgin islands
D. household islands
E. replicon islands.

Answer 23

A. genomic islands

Question 24

Which genetic marker is commonly incorporated into plasmid cloning vectors to facilitate
selection of host bacteria containing the plasmid?

A. anaerobic resistance
B. analogue resistance
C. antibiotic resistance
D. antibody sensitivity
E. catabolite repressor.

Answer 24

C. antibiotic resistance

Question 25

Copy or complementary DNA (cDNA) production from eukaryotes and cloning of this
cDNA in bacteria gets over the problem of:

A. exons
B. freons
C. introns
D. ions
E. neons.

Answer 25

C. introns

Question 26

Incubation of cells with colcemid is routinely used in cytogenetics. Which of the
following best describes the reasons for its use?

A. promotes entry of interphase cells into mitosis
B. preserves details of chromosome structure in fixed cells.
C. accumulates cells in metaphase and causes chromatid repulsion.
D. breaks down the nuclear membrane thus making chromosomes more visible
E. causes chromosome elongation enabling high resolution chromosome banding.

Answer 26

C. accumulates cells in metaphase and causes chromatid repulsion.

Question 27

Two polymorphic DNA markers are linked to different gene loci where mutations result
in a genetic disorder. Linkage between the first marker and gene locus A is 2cM;
linkage between the second marker and gene locus B is 20cM. In predictive testing
using the DNA markers, which marker is likely to be the most accurate and why?

A. both will be equally as good since recombination with each is less than 25%
B. both will be equally as good since recombination with each is less than 50%
C. neither since in both cases the marker and gene locus are not completely linked
D. locus B because crossing over is less likely to occur and produce a false result
E. locus A because crossing over is less likely to occur and produce a false result.

Answer 27

E. locus A because crossing over is less likely to occur and produce a false result

Question 28

Single nucleotide polymorphisms (SNPs) in humans:

A. are extremely abundant in the genome
B. occur non-randomly in the genome
C. may be associated with disease
D. all of the above
E. none of the above.

Answer 28

D. all of the above

Question 29

The effective population size (Ne) of the human mitochondrial genome compared to that
of the nuclear genome is:

A. 25%
B. 50%
C. the same
D. 200%
E. unknown

Answer 29

A. 25%

Question 30

When there is positive selection for an advantageous DNA variant, the selected DNA
variant will tend to increase in frequency in the population. The advantageous allele will
tend to be transmitted through generations together with adjacent segements of the
same chromosome (the size of which will gradually be reduced by recombination). A
genomic region which has been subject to this process will demonstrate extremely low
heterozygosity values. The process is known as:

A. heterozygote disadvantage
B. a selective sweep
C. balancing selection
D. linkage equilibrium
E. genetic drift.

Answer 30

B. a selective sweep