MCQ Flashcards
Transformation Experiment. In a bacterial transformation experiment the total
transformation mix volume was 1000 µl and contained 0.1µg of plasmid DNA. When
10µl aliquots of this mix were plated onto each of two nutrient agar antibiotic medium
plates and incubated at 37oC for 48 hours, 80 and 120 antibiotic resistant transformants
were obtained. What is the frequency of transformation per µg of plasmid DNA?
A. 4.0 x 106 transformants per µg B. 1.0 x 106 transformants per µg C. 4.0 x 105 transformants per µg D. 1.0 x 105 transformants per µg E. 1.0 x 104 transformants per µg.
D. 1.0 x 105
transformants per µg
In a complementation test, what unit of genetic information is represented by a single
complementation group?
A. nucleotide B. codon C. operon D. gene E. genome.
D. gene
Agarose gel electrophoresis. What are the three configurations in which bacterial
plasmid DNA can be most commonly observed?
A. open circle / linear / supercoiled B. closed circle / linear / supercoiled C. open circle / irregular / supercoiled D. open circle / linear / superscript E. closed circle / irregular / superscript
A. open circle / linear / supercoiled
In the context of prokaryotic gene expression, which of the following is the most
appropriate definition of an operator?
A. a cluster of genes that are regulated by a single promotor
B. a DNA-binding protein that regulates gene expression
C. a non-coding regulatory DNA sequence that is bound by RNA polymerase
D. a non-coding regulatory DNA sequence that is bound by a repressor protein
E. a section of DNA transcribed but not translated.
D. a non-coding regulatory DNA sequence that is bound by a repressor protein
In bacteria, what is the name for groups of genes that are involved in the same
metabolic pathway or functional characteristic, and are clustered together and under
the control of a single regulatory component?
A. genomic islands B. cistrons C. replicons D. operons E. telomeres
D. operons
Within a eukaryote gene, exons are:
A. sequences that are transcribed and translated into a polypeptide
B. sequences not transcribed
C. sequences transcribed but not translated
D. sequences necessary for replication
E. sequences involved in gene regulation
A. sequences that are transcribed and translated into a polypeptide
In female mammals, one X chromosome is largely inactivated. The inactivated X
chromosome has:
A. higher levels of acetylation of histone proteins
B. lower levels of acetylation of histone proteins
C. a lack of associated histone proteins
D. lower levels of DNA methylation
E. higher levels of DNA methylation
E. higher levels of DNA methylation.
The promoter sequences of eukaryote genes:
A. are located immediately adjacent to the genes they regulate and are considered to be part of the genes
B. are located some distance downstream of the genes which they regulate
C. are located some distance upstream of the genes which they regulate
D. always contain a TATA box, but never contain a CAAT box
E. always contain a CAAT box, but never contain a TATA box.
A. are located immediately adjacent to the genes they regulate and are considered to be part of the genes
Which of the following processes may be involved in the modification of nucleosome
histone proteins to either activate or repress eukaryote gene expression?
A. acetylation only B. methylation only C. acetylation and phosphorylation D. methylation and phosphorylation E. acetylation, methylation and phosphorylation.
E. acetylation, methylation and phosphorylation.
Long noncoding RNAs (lncRNAs) may repress transcription in eukaryotes by:
A. forming a complex with proteins to affect heterochromatin methylation
B. recruting a cofactor to the promotor thus preventing the binding of transcription
factors
C. forming a triple helix with promotor DNA thus preventing the binding of
transcription factors
D. all of the above
E. none of the above since lncRNAs only function by activating genes.
D. all of the above
Mutations can lead to:
A. malignancy or cancer B. heritable defects C. ageing D. none of the above E. all of the above.
E. all of the above.
Apoptosis or programmed cell death occurs:
A. at single cell level B. in a group of cells C. either at a single cell level or in a group of cells D. at tissue level E. at the organ level.
A. at single cell level
In the context of Ames mutagenicity test, ‘auxotrophs’ means organisms require:
A. no supply of one or more specific nutrients
B. additional supply of one or more specific nutrients
C. minimal supply of one or more specific nutrients
D. any of the above, but dependent on the specific test
E. none of the above.
B. additional supply of one or more specific nutrients
The sensitivity of the Ames test could be enhanced by:
A. inducing additional mutations in DNA repair genes
B. inducing mutations in genes which could allow entry of larger molecules into the
cells
C. adding liver enzymes which could metabolise the chemicals
D. all of the above
E. none of the above.
D. all of the above
The p53 gene is:
A. a tumour suppressor gene
B. known as “guardian of the genome”
C. mutated in approximately 60% of cancers
D. involved in a check point at the G1/S border
E. all of the above.
E. all of the above.
Which of the following base analogues is required when cells are grown under in vitro
conditions for the analysis of sister chromatid exchanges (SCEs) for biomonitoring
purposes:
A. 5-bromodeoxyuridine (BrdU or BudR) B. uridine C. inosine D. uridine and inosine E. none of the above.
A. 5-bromodeoxyuridine (BrdU or BudR)
For biomonitoring purposes, the fluorescent in situ hybridisation (FISH) technique is an
efficient method to analyse:
A. chromosomal aberrations and aneuploidy B. mutations in specific genes C. sister chromatid exchanges (SCEs) D. DNA strand breaks E. DNA adducts.
A. chromosomal aberrations and aneuploidy
Polymerase Chain Reaction (PCR). Given that the temperature in degrees Celsius (t)
at which half the PCR primers in a reaction will bind to template DNA = 4(G+C) +
2(A+T), determine the optimal annealing temperature for use in a PCR for the two PCR
primers below:
Primer 1 : 5‘ GGATCGGCATGCCCTTATTAA ‘3
Primer 2 : 5’ TTGGTATTCCTTTCATGGGAG ‘3
A. 2 oC B. 60 oC C. 61 oC D. 62 oC E. 122 oC.
D. 62 oC
not sure though
Primer 1 60 degrees
Primer 2 62 degrees
The genome of a cellular life form consists of its entire:
A. gene content B. regulatory regions controlling gene expression C. DNA sequences D. cistronic information E. RNA coding sequences.
C. DNA sequences
In gene cloning experiments, one reason why bacteria are poor hosts for expressing
eukaryotic genes is their inability to:
A. post-translationally modify proteins B. sexually reproduce C. modify lipid metabolism D. modify carbohydrate metabolism E. modify nucleic acid metabolism.
A. post-transcriptionally modify proteins
An animal or plant which has foreign gene(s) introduced into its genetic make-up and
passes on those genes to it’s offspring is known as:
A. transallelic B. transformed C. transmutable D. transgenomic E. transgenic
E. transgenic.
Tautomerism: at what frequency do rare enol or imino forms of nucleotide bases occur in living cells? A. 1 in 106 B. 1 in 105 C. 1 in 104 D. 1 in 103 E. 1 in 102
E. 1 in 102
In bacteria, large transposable, mobile genetic elements, which carry many genes are
known as:
A. genomic islands B. recombinant islands C. virgin islands D. household islands E. replicon islands.
A. genomic islands
Which genetic marker is commonly incorporated into plasmid cloning vectors to facilitate
selection of host bacteria containing the plasmid?
A. anaerobic resistance B. analogue resistance C. antibiotic resistance D. antibody sensitivity E. catabolite repressor.
C. antibiotic resistance
