Manipulating Genomes Flashcards
Define bioinformatics?
Collecting and analysing biological data (e.g. genetic sequences), using special software programmes.
Define DNA profiling?
A technique used to identify an individual from their DNA profile (their DNA pattern).
Define genetic engineering?
The artificial modification and recombination of DNA/nucleic acids to modify an organism.
Define gene therapy?
The introduction of normal genes into cells in place of missing or defective ones in order to correct genetic disorders.
Define gene?
a section of DNA coding for a polypeptide
Define restriction endonucleases?
An enzymes from a bacteria which carry out hydrolysis at specific recognition sites along the DNA.
Define gel electrophoresis?
A technique used to separate DNA and protein fragments in order of their size.
Define primer?
Short single-stranded DNA sequence used to initiate DNA synthesis/a sequencing reaction.
Define haploid?
A cell containing a single set of unpaired chromosomes
Define diploid?
A cell containing two complete sets of chromosomes, one from each parent.
Process for automated DNA sequencing?
1) Start with the sequencing mixture: DNA polymerase, single stranded template DNA strands, primer, free normal DNA nucleotides + fluorescently marked terminator nucleotides.
2) Amplify template DNA strands using PCR.
3) Primer anneals to DNA strand at the 3-prime end of your template strand followed by DNA polymerase binding which catalyses the addition of free nucleotides to SS-DNA template strand using complementary base pairing rules.
4) When a fluorescently marked nucleotide binds, DNA polymerase is ‘thrown off’ & the reaction stops on that specific template.
5) Many double stranded DNA molecules are made – these vary in length and all possible lengths of DNA strands are produced as fluorescently marked nucleotide binds to the many template strands made through PCR at every possible position (collectively) on the different strands.
6) All the strands are then separated in order of mass (and thus length) using electrophoresis.
7) The colour of the fluorescent terminating nucleotide on every possible length of strand is read in order of increasing length using a laser too produce a chromatogram. This determine the base sequence of the original DNA strand.
Method of pyrosequencing:
1) Amplify single stranded DNA template via PCR
2) Starting mixture contains primer, DNA template, enzymes and substrates The enzymes are DNA polymerase, ATP sulfurylase, Luciferase, Apyrase, Substrates: Adenosine 5’ phosphosulphate (APS), Luciferin). The starting mixture is incubated.
3) First add one of 4 activated nucleotides: ATP, GTP, CTP, TTP
A = Adenine G = Guanine C = Cytosine T = Thymine
4) The dNTP will bind to the bases on the DNA template strand following complementary base pairing rules.
5) Upon binding, pyrophosphate (PPi) is released which is converted to ATP in presence of APS by ATP sulfurylase
7) Luciferase, in the presence of ATP then converts luciferin to oxyluciferin and this reaction generates visible light which is detected by a computer. You repeat this process with the other three activated nucleotide to eventually create a pyrogram
What does the generated visible light in pyrosequencing tell us?
The amount of light generated is proportional to the amount of ATP availablet. Therefore the more light produces, the more of the same activated nucleotide anneals adjacentl/in succesion to the complementary DNA strand.
*WATCH ANIMATION AT NEW-MEDICAL.NET ON PYROSEQUENCING!!
As the polymerase molecules move along the, the peaks on the graph form so we can see the order as well, so if time was along the bottom, initial peaks would indicate that the activated nucleotides have bonded to template strand near the start. If the line becomes horizontal (light intensity of 0) after that and then only produced a peak later, then we can see that the activated nucleotide that we are using did not bind at this point. However when we repeat this process with all the other activated nucleotides, peaks will form here and eventually it will become peak after peak. If there is a double peak next to a single peak, that indicated two activated nucleotides joined onto the template adjacent, whereas previously there was only one activated nucleotide. Triple peak = three activated nucleotides joined adjacently.
How is the process of pyrosequencing made continuous?
Apyrase enzyme continuously degrades ATP and free/unicorporated dNTPs during this process. This switches off the light and regenerates the reaction mixture, so that the process can be repeated with another dNTP/activated nucleotide.
The human genome has now been sequenced. What has this allowed for?
- Genome-wide comparisons between individuals of the same species and between different species (comparative gene mapping)
- The prediction of amino acids that will make up a polypeptide – with the genome known, its less time consuming as the triplet of bases can be translated into amino acids.
- The development of synthetic biology.
Benefits of genome-wide comparison between species and between individuals of the same specie?
- Allowed us to establish evolutionary relationships between species between species (the more similar the genomes between species, the more closely related and that genes that work well are conserved over time)
- Also beneficial to medical research e.g. pigs and human have similar genes for insulin, therefore in the past pig insulin was used to treat humans with diabetes. Furthermore, by looking for associations between substitution mutations (single nucleotide polymorphisms, SNPs) and susceptibility to disease = reveals which alleles are associated with higher risk of getting a disease.
- Comparing genomes of individuals enables differences to be identified which can then be used for development of personalised medicine tailored to a particular genome, as well as in studies of human disease.
- Comparing pathogenic and non-pathogenic genomes can be used to identify which elements of DNA are disease-causing.
How similar are the genomes of individuals in the same specie?
All humans, for example, are genetically similar – only 0.1% of our DNA is not shared with others.
What is one way of doing this?
Methylation! After we have mapped the whole genome, we can map the methylation of the whole genome. Methylation [adding methyl groups] of the DNA molecule is a natural biological process, changing the activity of the gene but not actually the base sequence. This can, for example, switch off a gene [allows a cell to control gene expression]. If researchers can map where/how this happens, it can help them understand why some cancers will/will not develop in genetically similar people = called epigenetics.
What is synthetic biology?
Engineering new biological systems or re-designing existing ones for useful purposes.
Applications of synthetic biology applications:
- Information storage
- Production of medicines
- Novel Proteins
One of the applications of synthetic biology is information storage. What does this mean?
Digital information can be encoded onto a single strand of synthetic DNA.
One of the applications of synthetic biology is production of medicines. What does this mean?
For example, yeast has been genetically modified to produce the precursor of an antimalarial drug.
*precursor: starting substance
One of the applications of synthetic biology is novel proteins. What does this mean?
These are proteins artificially synthesised. Using human genome, we have synthesized a similar protein to haemoglobin, which binds to oxygen but not carbon monoxide.
What are some of the issues with synthetic biology?
Synthetic biology raises issues of ethics and biosecurity.
Procedure for DNA profiling:
1) DNA obtained from individuals e.g. mouth swab
2) Cells are broken down to release DNA, if there is only a small amount of DNA available it can be amplified using “PCR”.
3) DNA digested with restriction enzymes – these enzymes cut DNA at specific recognition sites to produce fragments of DNA (aka restriction fragments) – fragments will vary in size.
4) Fragments separated by gel electrophoresis + stained – larger fragments travel the shortest distance in the cell. This produces a banding pattern.
5) The DNA to which the individual’s is being compared to is treated with the same restriction enzymes and also subjected to electrophoresis.
6) Banding patterns of the DNA samples can then be analysed and compared with e.g. a banding pattern produced from a DNA sample from a crime scene or from a database.
* Where exactly does the restriction enzymes bind to and how do they know where to bind? Also why does the fragments produced after cutting up the enzymes vary in length from individual to individual?
How does gel electrophoresis work?
DNA fragments are injected into wells and an electric current is applied along the gel. DNA is negatively charged so it is attracted to the positive end. The DNA separates on basis of size as the shorter fragments move faster through the gel.
What did the procedure of DNA analysis that I have written about involve and is this method still widely used?
Restriction fragment length polymorphism analysis – this is the differences among individuals in the lengths of DNA fragments cut by enzymes. However this method is no longer used as it is laborious.
*What is a polymorphism? Even though we are all unique, most of our DNA is actually identical to other people’s DNA. However, specific regions vary highly between people. These regions are called polymorphic. Differences in these variable regions between people are known as polymorphisms.
What is the other method of DNA profiling that is currently used?
A process using Short Tandem Repeat (STR) sequences of DNA.
What are STRs?
One of the current techniques for DNA profiling uses polymorphisms called short tandem repeats. Short tandem repeats (or STRs) are regions of non-coding DNA that contain repeats of the same nucleotide sequence. For example, GATAGATAGATAGATAGATAGATA is an STR where the nucleotide sequence GATA is repeated six times. STRs are found at different places or genetic loci in a person’s DNA but the locations are the same for all individuals and the bases of an STR that repeats is the same in all human beings however the number of repeats that occurs at each loci varies. The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7 (of all human genomes), contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR. An individual with D7S820 alleles 10 and 15, for example, would have inherited a copy of D7S820 with 10 GATA repeats from one parent, and a copy of D7S820 with 15 GATA repeats from his or her other parent.
*What is a polymorphism? Even though we are all unique, most of our DNA is actually identical to other people’s DNA. However, specific regions vary highly between people. These regions are called polymorphic. Differences in these variable regions between people are known as polymorphisms.
*IS THE BASES THAT REPEAT THE SAME – IT IS ONLY THE NUMBER OF REPEATS THAT VARIES AND GIVES RISE TO DIFFERENT ALLELES? LOOKING AT THE PICTURE BELOW SUGGESTS THAT THE MATERNAL AND PATERNAL CHROMOSOMES IN A CHILD WILL BE DIFFERENT SIZES BY A NUMBE ROF NUCLEOTIDES – IS THIS CORRECT?
Describe the process involving STR sequences of DNA.
DNA sample obtained from individual and the regions containing 13 pre-chosen STRs are identified and fluorescently marked. They are then amplified using PCR and resolved according to size using gel electrophoresis, giving an overall profile of STR sizes as peaks on a graph. From this, the length of all 13 STRs can be determined and compared with the graph of another individual who is a suspect/in the database.
*There is 5-2-% chance that a single STR will be the same between individuals. This is why 13 different STRs are analysed, because the chances of two people sharing STR sequences at all the loci is 1x10^18. Twins have the same 13 STRs however.
Uses of DNA profiling?
Forensic science
Maternity and Paternity Disputes
Analysis of Disease
