LS 7C - Part 2 Flashcards
Which process is responsible for creating MOST of an animal’s nitrogenous waste?
A. protein breakdown during metabolism
B. respiration
C. consuming nitrogen in food
D. toxins in the environment
A. protein breakdown during metabolism
One of the functions of the cardiovascular and respiratory systems is to rid the body of CO2. Where does the CO2 come from?
A. CO2 is a breakdown product of the carbohydrates oxidized in cellular respiration.
B. CO2 is a breakdown product of the carbohydrates reduced in cellular respiration.
C. CO2 is produced when inhaled oxygen combines with carbon atoms from carbohydrates.
D. CO2 is produced when the oxygen atoms of water combine with carbon atoms.
A. CO2 is a breakdown product of the carbohydrates oxidized in cellular respiration.
The lungs are highly branched. What is the primary purpose of this branching?
A. It increases the surface area of the lungs
B. It increases the volume of the lungs
C. A and B are correct
D. None of the above
A. It increases the surface area of the lungs
A red blood cell has just left the right ventricle of the heart. It travels to the lungs, back to the heart, to the liver, and then back to the heart again. At each point on its journey (A-D), determine the oxygen saturation level (%) of the hemoglobin molecules found in this red blood cell. (You may assume the pH of the blood is 7.4.)
What is the approximate O2 saturation at point D?
A. 75%
B. 30%
C. 40%
D. 10%
E. None of the above
A. 75%
How does blood pH at muscle tissue compare to blood pH at the lungs?
A. Blood pH is higher at the muscle
B. Blood pH is lower at the muscle
C. Blood pH is the same at the muscle
B. Blood pH is lower at the muscle
If carbonic anhydrase stopped working, the amount of oxygen delivered to systemic tissues would _________.
A. Increase
B. Decrease
C. Not change
B. Decrease
The same red blood cell leaves the heart again, but this time instead of traveling to the liver, it travels to a skeletal muscle that is actively respiring. At each point on its journey (A-D), determine the oxygen saturation level (%) of the hemoglobin molecules found in this red blood cell.
What is the approximate O2 saturation at point D?
A. 75%
B. 25%
C. 40%
D. 10%
E. None of the above
D. 10%
When the diaphragm contracts, the volume of the lungs _____ and the pressure in the lungs ______
A. Increases; increases
B. Increases; decreases
C. Decreases; increases
D. Decreases; decreases
B. Increases; decreases
At high altitudes, the partial pressure of oxygen is ______ the partial pressure of oxygen at sea level.
A. Higher than
B. Lower than
C. The same as
B. Lower than
At high altitudes, the percentage of oxygen is ___________ the percentage of oxygen at sea level.
A. Higher than
B. Lower than
C. The same as
C. The same as
Sea level O2 is 21% Total Pressure = 760 mm/Hg Partial pressure of oxygen is 160 mm/Hg
At 10,000 feet O2 is 21% Total Pressure = 523 mm/Hg Partial pressure of oxygen 110 mm/Hg
A climber is scaling Mt. Everest. As her elevation increases, the average amount of oxygen bound to the hemoglobin in her red blood cells ________.
A. Increases
B. Decreases
C. Does not change
B. Decreases
A condition called “hypoxia” occurs when not enough oxygen is being delivered to the body. Chemoreceptors on the ________ sense oxygen levels in the blood and relay this information to respiratory control centers in the brain.
A. Aorta
B. Pulmonary trunk
C. Pulmonary vein
D. Superior vena cava
A. Aorta
Follow-up: Why does it make the most sense to monitor oxygen levels in the aorta?
A condition called “hypoxia” occurs when not enough oxygen is being delivered to the body. What is acting as the homeostatic sensor?
A. Oxygen
B. Carbon Dioxide
C. Heart
D. Brainstem
E. Diaphragm
A condition called “hypoxia” occurs whennot enough oxygen is being delivered to the body. When brainstem senses hypoxicconditions, the rate of ventilation will …
A. Increase
B. Decrease
C. Not change
A. Increase
How many cell membranes does a carbon dioxide molecule diffuse through to move from the cytosol of a red blood cell to the inside of an alveolus in the lungs?
A. 1
B. 2
C. 3
D. 4
E. 5 or more
E. 5 or more
Patient A received a complete blood count while Patient B received a chemistry panel. Based on the results, which test analyzes the composition of the cellular portion of the blood?
A. Complete blood count
B. Chemistry panel
C. No way to know
A. Complete blood count
True or False:
Patient B’s blood pH is buffered by the appropriate amount of bicarbonate
True
True or False:
Patient A’s blood will likely exhibit difficulty clotting.
False
True or False:
Patient B likely exhibits some swelling of the body tissues (“edema”) due to an osmotic imbalance in his blood.
True
Low plasma protein concentrations will make the blood hypotonic compared to the interstitial fluid around capillaries. As a result, water will tend to leave the blood, causing surrounding tissues to swell.
Label these structures on the diagram:
Right Atrium
Right Ventricle
Left Atrium
Left Ventricle
Superior Vena Cava
Inferior Vena Cava
Pulmonary Artery
Pulmonary Vein
Aorta
Which of the following correctly represents the order in which blood flows through structures of the heart?
A. Right ventricle, left atrium, pulmonary artery
B. Left atrium, pulmonary artery, right atrium
C. Pulmonary artery, aorta, left ventricle, Pulmonary Circuit
D. Superior vena cava, pulmonary vein, aorta
D. Superior vena cava, pulmonary vein, aorta
True or False:
The pulmonary vein carries deoxygenated blood.
False
Arteries carry blood away from the heart and veins carry blood back to the heart. The pulmonary vein carries oxygenated blood from the pulmonary circuit back to the heart.
At the beginning of ventricular diastole, blood pressure in atria is _______ blood pressure in the ventricles.
A. Higher than
B. Lower than
C. The same as
D. No way to know!
A. Higher than
Blood flows down pressure gradients from high to low pressure
The ventricles begin to empty at which region of the cardiac cycle?
C
At the time that the ventricles begin to empty, blood pressure in aorta is _______ blood pressure in the ventricles.
A. Higher than
B. Lower than
C. The same as
D. No way to know!
B. Lower than
During a typical cardiac cycle, cell depolarization triggers muscle _______ and repolarization triggers muscle ________.
A. Contraction; contraction
B. Contraction; relaxation
C. Relaxation; contraction
D. Relaxation; relaxation
B. Contraction; relaxation
Depolarization and repolarization… sounds like we’re talking about action potentials. Do muscles have action potentials?
A. Totally!
B. No way!
C. How should I know?
A. Totally!
During a typical cardiac cycle, the atria of the heart contract ______ the ventricles contract.
A. Before
B. After
C. At the same time as
A. Before
The ventricles finish filling with blood after the _______.
A. Atria depolarize
B. Atria repolarize
C. Ventricles depolarize
D. Ventricles repolarize
A. Atria depolarize
When do the ventricles depolarize?
A. P wave
B. PR segment
C. QRS complex
D. ST segment
E. T wave
C. QRS complex
When do the atria repolarize?
A. P wave
B. PR segment
C. QRS complex
D. ST segment
E. T wave
C. QRS complex
What does the ST interval represent?
A. The heart is relaxing
B. The ventricles are filling
C. The atria are filling
C. The atria are filling
What happens during the P wave?
A. Atria depolarize
B. Atria repolarize
C. Ventricles depolarize
D. Ventricles repolarize
A. Atria depolarize
Which region on the EKG corresponds to number 2 on the figure??
D.
Signals from the sympathetic nervous system cause arteriole B to constrict. As a result, the amount of blood flowing through the other three arterioles will ____________.
A. Increase
B. Decrease
C. Not change
A. Increase
Signals from the sympathetic nervous system cause arteriole B to constrict. Arteriole B is most likely carrying blood to ________. (Hint: fight or flight)
A. The brain
B. The small intestine
C. A leg muscle
D. The heart
B. The small intestine
Consider two chambers of equal volumes. The chambers are separated by a selectively permeable membrane that only allows water through.
What will happen to the water molecules?
A. Net movement to the right
B. Net movement to the left
C. No net movement
A. Net movement to the right
Consider two chambers of equal volumes. The chambers are separated by a selectively permeable membrane that only allows water through.
What will happen to the water molecules?
A. Net movement to the right
B. Net movement to the left
C. No net movement
C. No net movement
Consider two chambers of equal volumes. The chambers are separated by a selectively permeable membrane that only allows water through.
What will happen to the water molecules?
A. Net movement to the right
B. Net movement to the left
C. No net movement
A. Net movement to the right
In the proximal convoluted tubule, which of the following molecules is being secreted?
A. Sodium
B. Potassium
C. Glucose
D. Urea
E. All of the above
D. Urea
Consider the figure below.
True or False:
The osmolarity of tissue fluids surrounding the nephron is higher at point D than at point G.
True
Consider the figure below.
Around point F, the extracellular fluid surrounding the nephron is _______ compared to the fluid in the lumen of the nephron.
A. Hypertonic
B. Hypotonic
C. Isotonic
A. Hypertonic
Consider the figure below.
True or False:
The cells around region B use more ATP than those in region G.
False
Follow-up: in what region(s) of the nephron would you expect to find high numbers of sodium/potassium pumps?
Increased osmolarity of body fluids__________ ADH secretion
A. Increases
B. Decreases
C. Has no effect on
A. Increases
Increased ADH secretion__________ urine output
A. Increases
B. Decreases
C. Has no effect on
B. Decreases
Decreased Na+ in body fluids (Na+depletion) __________ renin secretion
A. Increases
B. Decreases
C. Has no effect on
A. Increases
When the volume of blood passing through the kidney increases, renin production by the kidney will most likely _________.
A. Increase
B. Decrease
C. Stay the same
B. Decrease
ACE inhibitors are drugs that inhibit an enzyme called ACE that converts angiotensin I into angiotensin II. Treatment with an ACE inhibitor will cause blood pressure to _________.
A. Increase
B. Decrease
C. Stay the same
B. Decrease
True or False:
The marathon runner’s muscles aren’t working well, you determine itis not due to fatigue. They have been drink water at each watering station.
They are still dehydrated and should drink water.
False
The runner begins to experience a headache, and their body temperature has risen slightly. The first aid station gives them water thinking they have heat stroke
The runner’s headache will get
A. Worse
B. Better
C. Stay the same
A. Worse
Carbonic anhydrase inhibitors are commonly prescribed to treat glaucoma. A side effect could be ___________ in stomach pH.
A. An increase
B. A decrease
C. No change
A. An increase
Secretin stimulates the release of bicarbonate ions into the duodenum, which neutralizes acidic chyme from the stomach. One consequence of neutralizing the pH in the intestine is that:
A. Carbohydrates are not as easily broken down in this neutral environment
B. Enzymes that catalyze the breakdown of carbohydrates are denatured
C. Enzymes that catalyze the breakdown of carbohydrates are active
D. The enzymatically catalyzed breakdown of carbohydrates that began in the stomach is halted in the duodenum
C. Enzymes that catalyze the breakdown of carbohydrates are active
Based on the diagram shown here, ______ concentration in the duodenum is homeostatically regulated.
A. Bicarbonate
B. Bile
C. CCK
D. H+ ion
E. Secretin
D. H+ ion
When stomach acid reaches the duodenum, it triggers the release of bicarbonate ions, which increase the pH of the duodenum. This is an example of:
A. Negative feedback
B. Positive feedback
C. Neither; this is not a feedback system
A. Negative feedback
Antacids like pepto-bismal are commonly taken to increase the pH of the stomach. If you take an antacid with your meal, _____ secretin will be released by your duodenum compared with eating an identical meal without an antacid.
A. More
B. Less
C. An equivalent amount of
B. Less
The motility of the digestive tract and secretion of
digestive enzymes are optimized for digestion and absorption. For most nutrients, once material is in the digestive tract, the digestive system does not vary its rate of absorption according to body needs.
A. This is an example of a homeostatic positive feedback mechanism
B. This is an example of a homeostatic negative feedback mechanism
C. This response is not homeostatic
C. This response is not homeostatic
You add a toxin that prevents the Na+/K+pump from hydrolyzing ATP. Absorption of which nutrient(s) will be affected?
A. Glucose only
B. Amino acids only
C. Both glucose and amino acids
D. Neither will be affected
C. Both glucose and amino acids
What is your prediction:
A. All experimental groups will show changes in body weight.
B. Only the db/db + ob/ob experimental group will show changes in body weight
C. Only the db/db + Lean (WT) and ob/ob + Lean (WT) experimental groups will show changes in body weight
D. None of the experimental groups will show changes because they all die from septic shock
A. All experimental groups will show changes in body weight.
True or False:
Is this an accurate null hypothesis:
None of the experimental groups will exhibit changes in body weight.
True
True or False:
Based on these results, it can be concluded that db/dbmice lack the receptor for the hormone leptin.
True
True or False:
Based on these results, it can be concluded that db/db mice do not make the hormone leptin.
False
True or False:
Based on these results, it can be concluded ob/ob mice do not produce the hormone leptin.
True
(see picture)
Name the blood electrolytes and what they do.
Sodium
Potassium
Calcium
Magnesium
Chloride
Bicarbonate
Osmotic balance, pH buffering, regulation of membrane permeability.
Name 3 plasma proteins and what they do.
Albumin - Osmotic balance, pH buffering
Fibrinogen - clotting
Immunoglobulins (antibodies) - defense
What is water’s function in blood plasma?
It is a solvent for carrying other substances.
What substances are transported by the blood?
Nutrients such as glucose, fatty acids, vitamins.
Waste products of metabolism.
Respiratory gases (O2 and CO2.)
Hormones
Technical name of red blood cells and function.
Erythrocytes transport oxygen and help transport CO2.
Technical name of white blood cells, the 5 types and what they do.
Leukocytes:
- Basophil
- Neutrophil
- Eosinophil
- Lymphocyte
- Monocyte
These all provide defense and immunity.
Sometimes while traveling, people are infected with a protist parasite, Giardia. One of the side effects of Giardia infection is diarrhea. When someone has diarrhea, they lose excessive water and salt from the body. The result is loss of Na+, dehydration that leads to decreased extracellular volume and plasma volume, and decreased arterial blood pressure. Given this would the vasopressin secretion of a person infected with Giardia:
A. stay the same
B. decrease
C. increase
C. increase
One of the effects of the hormone secretin is to stimulate the release of bicarbonate ions into the duodenum, which neutralizes the acid that enters the duodenum with food from the stomach. One consequence of neutralizing the pH in the intestine is that:
A. enzymes that catalyze the hydrolysis of carbohydrates are active.
B. the enzymatically catalyzed hydrolysis of carbohydrate that began in the stomach is halted in the duodenum.
C. enzymes that catalyze the hydrolysis of carbohydrates are denatured.
D. carbohydrates are not as easily broken down in this neutral environment.
A. enzymes that catalyze the hydrolysis of carbohydrates are active.
Instructional Guidance: This question requires the application of knowledge of what happens in stomach and duodenum.
The duct that connects the pancreas to the duodenum can sometimes become blocked. What is the result?
A. Nothing happens because the pancreas does not produce digestive enzymes.
B. The digestive enzymes back up into the pancreas and may start to digest the pancreas.
C. The digestive enzymes produced by the pancreas still enter the duodenum because they travel by the blood to reach the duodenum, not by a duct.
D. The digestive enzymes produced by the pancreas enter the large intestine instead and digestion proceeds as normal.
E. The digestive enzymes are not affected because they are stored in the gallbladder until they are needed in the duodenum.
B. The digestive enzymes back up into the pancreas and may start to digest the pancreas.
Glucose enters the epithelial cells of the small intestine against its concentration gradient. Select the BEST explanation from the following.
A. Glucose is co-transported with Na+, which moves down its concentration gradient into the cell.
B. Glucose is co-transported in the Na+/K+ pump.
C. Glucose is transported through a glucose pump in the apical membrane that hydrolyzes ATP to ADP and Pi.
D. Glucose enters by diffusion.
E. Glucose follows the water that is pumped into the cell.
A. Glucose is co-transported with Na+, which moves down its concentration gradient into the cell.
The loop of Henle is a countercurrent exchanger because it creates a concentration gradient rather than simply maintaining it.
A. False
B. True
A. False
One of the roles of the kidneys is to help buffer body fluids so that they are not too acidic or too basic. The cells of the renal tubule secrete H+ into the tubule lumen, and absorb bicarbonate (HCO3–), passing it into the tissue fluid. Consider the reaction catalyzed by the enzyme carbonic anhydrase, shown in the accompanying figure and below.
During heavy exercise, the reaction shifts to the right in the nephron (lumen of the tubule).
A. False
B. True
B. True
Referring to Figure 10.14, identify which type of cell-cell interaction is most likely to force the products of digestion to be absorbed across microvilli of intestinal cells rather than allowing them to leak between cells.
A. tight junctions
B. desmosomes
C. hemidesmosomes
D. gap junctions
E. plasmodesmata
A. tight junctions
You discover a new type of marine organism that has the kidneys of a fish but no gills. What effect would the absence of gills have on excretion of nitrogenous waste?
A. No effect. Nitrogenous wastes diffuse across the skin.
B. Nitrogenous excretion decreases because no nitrogen uptake is occurring at the gills.
C. No effect. Fish kidneys excrete all nitrogenous waste.
D. Nitrogenous excretion increases at the kidneys because it cannot be lost at the gills.
D. Nitrogenous excretion increases at the kidneys because it cannot be lost at the gills.
Assume that blood pressure drops in a person because of an injury. Indicate which of the following occur by selecting “true” for does occur or “false” for does not occur.
Circulating levels of aldosterone will increase.
True
False
True
Assume that blood pressure drops in a person because of an injury. Indicate which of the following occur by selecting “true” for does occur or “false” for does not occur.
Circulating levels of renin will decrease.
True
False
False
Assume that blood pressure drops in a person because of an injury. Indicate which of the following occur by selecting “true” for does occur or “false” for does not occur.
The sympathetic nervous system stimulates the adrenal glands.
True
False
True
Assume that blood pressure drops in a person because of an injury. Indicate which of the following occur by selecting “true” for does occur or “false” for does not occur.
Water absorption by the distal convoluted tubule will decrease.
True
False
False
Assume that blood pressure drops in a person because of an injury. Indicate which of the following occur by selecting “true” for does occur or “false” for does not occur.
Circulating levels of angiotensin II will increase.
True
False
True
Freshwater fish are in a hypotonic environment. How do their gill chloride cells function in this environment?
A. Freshwater fish have chloride cells that actively move chloride ions out of the gills into the surrounding water, with sodium ions following.
B. Freshwater fish have chloride cells that actively move chloride ions into the gills, with sodium ions moving in the opposite direction.
C. Freshwater fish have chloride cells that actively move chloride ions out of the gills into the surrounding water, with sodium ions moving in the opposite direction.
D. Freshwater fish have chloride cells that actively move chloride ions into the gills, with sodium ions following.
D. Freshwater fish have chloride cells that actively move chloride ions into the gills, with sodium ions following.
One of the hormones not mentioned in the text is GIP (glucose-dependent insulin trophic peptide), which stimulates the secretion of insulin. It is secreted by cells of the duodenum in response to the presence of glucose. Its secretion and action on insulin production is an example of a:
A. homeostatic negative feedback mechanism keeping a system near a set point.
B. homeostatic negative feedback mechanism changing the set point.
C. homeostatic positive feedback mechanism amplifying the response to glucose ingestion.
A. homeostatic negative feedback mechanism keeping a system near a set point.
Chemoreceptors in the circulatory system detect changes in circulating pCO2. If CO2 concentrations get too high, the rate of ventilation increases. Why does this make sense?
A. Actually it doesn’t make sense. There is no relationship between CO2 and ventilation rate.
B. It makes sense because tissues that are more actively working produce more CO2.
C. It makes sense because CO2 is formed from O2, and therefore CO2 is a sign that oxygen is being consumed.
D. It makes sense because hemoglobin carries CO2 and therefore blocks oxygen binding to the heme site, creating an oxygen deficiency.
B. It makes sense because tissues that are more actively working produce more CO2.
Consider the figure below showing an EKG trace below the typical action potential for the sinoatrial node. Note: You haven’t seen the action potential for the pacemaker cells in the text. Indicate whether the following statements are true or false.
- Ventricular diastole occurs at the interval labeled 2 on the graph.
- Atria are emptying at the interval labeled 4 on the graph.
- False
- True
Bisphosphoglyceric acid (BPG) is a byproduct of glycolysis released into the bloodstream when an animal’s supply of oxygen is low. Like protons, it decreases hemoglobin’s affinity for O2. The effect of high BPG levels would be that:
A. hemoglobin holds on to more of its O2 than it would without BPG.
B. hemoglobin loses its cooperative binding of oxygen.
C. hemoblobin releases more of its bound O2 than it would without BPG.
D. hemoglobin now binds more oxygen at low partial pressures than at high partial pressures.
E. hemoglobin picks up more O2 in the lungs than it would without BPG.
C. hemoblobin releases more of its bound O2 than it would without BPG.
What are desirable characteristics for a gas exchange surface, such as the endothelial cells lining the inside of lung? (Select all that apply.)
A. a large surface area
B. a thickness under 10 micrometers
C. a small surface area
D. a thickness of 100 micrometers
A. a large surface area
B. a thickness under 10 micrometers
In systemic tissue fluids, the enzyme carbonic anhydrase catalyzes the reaction CO2 + H2O → H2CO3 (which then can dissociate into H+ and HCO3–). In fact, CO2 released from cells is converted to HCO3– ions and travels in that form in the bloodstream. HCO3– is reconverted to CO2 + H2O in the pulmonary capillaries by the same enzyme, and there the CO2 is exhaled. How is it possible for the same enzyme to catalyze reverse reactions?
A. The lungs contain an allosteric inhibitor that prevents the formation of carbonic acid.
B. There must be two forms of carbonic anhydrase. One form catalyzes the forward reaction CO2 + H2O → H2CO3 and the other catalyzes the reverse reaction H2CO3 →CO2 + H2O.
C. The direction of a reversible reaction is influenced by the concentrations of reactants and products. In pulmonary circulation, the low CO2 concentration favors the formation of CO2 and H2O.
C. The direction of a reversible reaction is influenced by the concentrations of reactants and products. In pulmonary circulation, the low CO2 concentration favors the formation of CO2 and H2O.
Instructional Guidance: This question covers the reversibility of reactions, the same enzyme catalyzing both forward and reverse reactions, and Le Chatelier’s principle.
During heavy exercise, the pO2 in muscle may drop to 20 mm Hg. Considering the oxygen-hemoglobin dissociation curve below, what is the approximate percent O2 saturation of hemoglobin in venous blood returning from skeletal muscles during heavy exercise?
A. approximately 50%
B. nearly 0%
C. approximately 20%
D. approximately 75%
E.approximately 100%
C. approximately 20%
Stimulation by the parasympathetic nervous system increases the permeability of the SA node to potassium ions, whereas stimulation by the sympathetic nervous system decreases the permeability of the SA node to this same ion.
A. False
B. True
A. False
During certain stressful moments, some individuals will begin to hyperventilate—that is, their breathing will be very shallow and quick. A by-product of hyperventilation is much lowered levels of CO2 in the blood. Which of the following would you also expect to find? (Select all that apply.)
A. increased blood pH, greater than 7.2
B. increased stimulation of chemoreceptors in the brainstem
C. decreased blood pH, less than 7.2.
D. decreased stimulation of chemoreceptors in the brainstem
A. increased blood pH, greater than 7.2
D. decreased stimulation of chemoreceptors in the brainstem
Instructional Guidance: Students should be able to integrate changes in gas concentration to changes in blood pH and receptor stimulus.
The random thermal motion of molecules from a region of higher concentration to a region of lower concentration is called diffusion. The rate of diffusion across a barrier is defined by Fick’s law of diffusion:
Rate of diffusion = k * A * (C2 – C1)
L
k = diffusion coefficient, which depends on solubility and temperature
A = surface area for exchange
C2 – C1 = difference in partial pressure of gas on either side of the barrier
L = thickness of the barrier to diffusion
In the design of respiratory systems, respiratory membranes 1 and 2 represent membrane barriers between the outside medium and the inside of the organism.
Which would have the higher rate of diffusion, respiratory membrane 1 or respiratory membrane 2?
A. respiratory membrane 2
B. respiratory membrane 1
A. respiratory membrane 2
The random thermal motion of molecules from a region of higher concentration to a region of lower concentration is called diffusion. The rate of diffusion across a barrier is defined by Fick’s law of diffusion:
Rate of diffusion = k * A * (C2 – C1)
L
k = diffusion coefficient, which depends on solubility and temperature
A = surface area for exchange
C2 – C1 = difference in partial pressure of gas on either side of the barrier
L = thickness of the barrier to diffusion
In the design of respiratory systems, respiratory membranes 1 and 2 represent membrane barriers between the outside medium and the inside of the organism.
Which term in the equation above is different between respiratory membranes 1 and 2?
A. A
B. k
C. L
D. C2 – C1
A. A
Label:
Right Atrium
Right Ventricle
Left Atrium
Left Ventricle
Superior Vena Cava
Inferior Vena Cava
Pulmonary Artery
Pulmonary Vein
Aorta
You are using mice to study the relationship between gut microbes and metabolism. You have three types of mice: mice with no microbes (GF), mice that gained microbes at a young age (CONV-D), and mice that gained microbes as adults (CONV-R). Results from two experiments are shown below.
Mice that have gut microbes eat _____ and have ________ metabolic rate compared to germ-free (GF) mice.
A. More; a higher
B. More; a lower
C. Less; a higher
D. Less; a lower
C. Less; a higher
You hypothesize that mice with microbes have less body fat than mice without microbes. You conduct a follow-up experiment, the results of which are shown below. What can you conclude from these data?
A. The data support the hypothesis
B. The data refute the hypothesis
C. The data don’t provideenough information to support or refute
B. The data refute the hypothesis
With a fluorescent marker, researchers were able to visualize species specific locations in the Zebrafish gut when colonized either Vibrio or Aeromonas
Based on my groups interpretation of the data provided, we can conclude:
A. Zebrafish have a preference forVibrio over Aeromonas.
B. Vibrio and Aeromonas are able to colonize distinct locations in the Zebrafish gut.
C. Both Vibrio and Aeromonas can co- exist in the Zebrafish gut due to their gut location preferences
D. We need more information to make any conclusions about this data.
B. Vibrio and Aeromonas are able to colonize distinct locations in the Zebrafish gut.
To determine if Aeromonas and Vibrio can co-exist in the Zebrafish gut you colonize germ free zebrafish larva with Aeromonas first and then expose the Zebrafish+Aeromonas to Vibrio. You sample and count the number of bacteria present in the gut at multiple times throughout the experiment. The results from you experiment are shown below:
Based on my groups interpretation of the data provided, we can conclude:
A. Aeromonas and Vibrio can co-exist in the larval zebrafish gut.
B. In the larval zebrafish gut, Aeromonasare able to out compete Vibriobecause they were the first colonizers.
C. Vibrio are able to out competeAeromonas in the larval zebrafish gut.
D. Vibrio are able to utilize food sources present in the larval zebrafish gut better than Aeromonas.
C. Vibrio are able to out competeAeromonas in the larval zebrafish gut.
Why can we NOT conclude D?
You are curious about the mechanism of completive exclusion present in the larval zebrafish gut so you fluorescently label Vibrio and Aeromonas and run the same colonization challenge experiment as before but measure the presence of each species over a smaller time scale (hours vs. days).
The results from your experiment are shown below.
Based on my groups interpretation of the data and information provided, we can conclude:
A. In the larval zebrafish gut, Aeromonasare able to out compete Vibriobecause they were the first colonizers.
B. Vibrio are able to utilize food sources present in the larval zebrafish gut better than Aeromonas.
C. Vibrio are able to out competeAeromonas in the larval zebrafish gut because the zebrafish host selectively eliminates only Aeromonas.
D. Vibrio are able to out competeAeromonas in the larval zebrafish gut because Vibrio are resistant to intestinal contractions
D. Vibrio are able to out competeAeromonas in the larval zebrafish gut because Vibrio are resistant to intestinal contractions
Mark A for True and B for False:
16s rRNA sequencing utilizes RNA to identify microbial species present in a microbiota sample.
False
16S rRNA sequencing utilizes the genes (DNA) that encode small ribosomal subunits (RNA + Proteins).
Mark A for True or B for False:
The data presented below is a measure of alpha diversity.
True
Mark A for True or B for False:
Person 1’s microbiome contains a larger % of proteobacteriathan Person 2’s microbiome.
False
Mark A for True or B for False:
Person 2 contains a greater alpha diversity than person 1.
False
Person 1 has bacteria from all 5 phyla including Tenericutes and Bacteroidetes. Person 2 only has bacteria from 3 phyla
Use the data provided below to answer the following question: Children with recurrent tonsillitis have less microbial diversity than healthy adults
A. True
B. False
C. Cannot be determined
C. Cannot be determined
Use the data provided below to answer the following question: Children with recurrent tonsillitis have microbiomes that are more similar to other children with recurrent tonsillitis than healthy adults.
A. True
B. False
C. Cannot be determined
A. True
Which of the four groups did Dr. Bello collect the most samples from?
A. Yanomami
B. Guahibo
C. Malawi
D. US
E. Can’t conclude from the data.
D. US
What type of microbial diversity is depicted here?
A. Alpha
B. Beta
C. Both
D. Neither
B. Beta
Surprisingly, the Yanomami tribe have similar microbiomes to the US.
A. True
B. False
C. Cannot be determined.
B. False
The Yanomami have more bacterial diversity than the US samples.
A. True
B. False
C. Cannot be determined.
C. Cannot be determined.
What type of diversity is being evaluated?
A. Alpha
B. Beta
C. Both
D. Neither
A. Alpha
If I increased the amount of sequences evaluated in a sample (independent variable; x-axis). Would Iexpect to detect…
A. More bacterial species.
B. Fewer bacterial species.
C. What is sequencing?
A. More bacterial species.
The more sequences of 16s rRNA genes you evaluate the more unique sequences you will discover leading to a greater ability to differentiate between similar species.
Which group has the most bacterial species diversity?
A. Yanomami
B. Guahibo
C. Malawi
D. US
A. Yanomami
What kind of cell is most directly responsible for the inflammationobserved in this cut?
A. Mast Cell
B. Neutrophil
C. Macrophage
D. B Cell
E. T Cell
A. Mast Cell
Mark A for True or B for False:
In addition to cells, individual proteins from theblood are helping to fight this infection
True
Suppose this cut gets infected by the bacteriumStaphylococcus aureus. While fighting off theinfection, some of your immune cells learn torecognize and “remember” this particularbacterium. Which immune cells are these?
A. Neutrophils
B. Macrophages
C. Mast Cells
D. B Cells
E. T Cells
D. B Cells
Suppose this cut gets infected by the bacterium Staphylococcus aureus. While fighting off the infection, some of your immunecells learn to recognize and “remember” this particularbacterium. Several days later, the same person gets another cut and is infected by the bacterium Streptococcus pyogens.
What point on the graph (A-E) best represents when the first cut is initially infected by S. aureus?
A
Mark A for True or B for False:
At point A there are no B Cells present in the blood that can bind to S. aureus
False
Suppose this cut gets infected by the bacterium Staphylococcus aureus. While fighting off the infection, some of your immunecells learn to recognize and “remember” this particularbacterium. Several days later, the same person gets another cut and is infected by the bacterium Streptococcus pyogens.
What point on the graph (A-E) best represents the maximum response to S. pyogens?
E
Based on the graph below, about how much moreantibody is produced in the secondary response compared to the primary response?
A.2x
B. 3x
C. 10x
D.100x
E. 1000x
E. 1000x
Compare the results for thyroid tumors and glioblastoma tumors. Which tumors have more mutations on average?
A. Thyroid
B. Glioblastoma
C. They are roughly the same
B. Glioblastoma
Compare the results for thyroid tumors and glioblastoma tumors. Which tumors vary more in mutation number?
A. Thyroid
B. Glioblastoma
C. They are roughly the same
A. Thyroid
Let’s assume there are about 6 total mutations that accumulate in a cellafter 20 rounds of division. How does your answer to the previous question compare to the data for thyroid tumors shown here?
A. It’s pretty similar (within an order of magnitude)
B. It’s totally different (more than 10x different)
C. There’s no way to say from these data
B. It’s totally different (more than 10x different)
Let’s say that there are 0.5 mutations per megabase in thepatient’s thyroid tumor. What is the approx. mutation rate?
A. 10-6
B. 10-7
C. 10-8
D. 10-9
C. 10-8
That’s 100 times higher than themutation rate for healthy cells!
The new data added below shows the source of mutations for each kind of tumor. What is the most prominent source of mutations in glioblastoma tumors?
A. Ultraviolet light
B. BRCA1/2 mutations
C. Tobacco smoke/products
D. CpG deamination
D. CpG deamination
Suppose two patients have inherited mutated copies of BRCA1 and have developed breast cancer. You collect tumor samples from each patient and look at the mutations.
True or False:
These tumors will have mostly the same mutations.
False
Suppose two patients have inherited mutated copies of BRCA1 and have developed breast cancer. You collect tumor samples from each patient and look at the mutations.
True or False:
If they have children, these patients can pass all of the new tumor mutations on to their offspring.
False
True or False:
The majority of tumor mutations occur in protein-coding regions of the genome.
False
True or False:
The same primer could be used to sequence all of the DNA fragments shown here.
False
All of these fragments have different nucleotide sequences!
The three DNA fragments below are about tobe sequenced using the primer 5’-CCGGG-3’.How many different sequencing reads will be recorded by this sequencing reaction?
A.1
B.2
C.3
D.More than 3
E. No way to know
B.2
The three DNA fragments below are about tobe sequenced using the primer 5’-CCGGG-3’.What is the 4th nucleotide in the sequencing read for first DNA fragment below?
A. A
B. T
C. C
D. G
A. A
How many different sequences are represented in this dataset?
A. 1
B. 2
C. 3
D. 4
E. 5 or more
B. 2
Which of the following sequences is (are) represented in this dataset?
A. 5’-CCGGTA-3’
B. 5’-CGGGTA-3’
C. Both of these
D. Neither of these
D. Neither of these
Remember: DNA synthesis occurs 5’ to 3’
True or False:
This tumor has more rearrangements in chromosome 10 than in chromosome 20
False
True or False:
There is a sequencing read from this tumor genome that maps to both chromosome 17 and chromosome 9 of the reference genome.
True
True or False:
This tumor probably has an extra copy of chromosome 8.
False
Which tumor has more chromosomal rearrangements?
A. Tumor 1
B. Tumor 2
C. They are about the same D. Not enough information
A. Tumor 1
Which tumor has more SNPs?
A. Tumor 1
B. Tumor 2
C. They are about the same
D. Not enough information
D. Not enough information
Which tumor has more chromosomal deletions?
A. Tumor 1
B. Tumor 2
C. They are about the same
D. Not enough information
B. Tumor 2
How many exons are in this gene model?
A. 9
B. 7
C. 6
D. 5
E. None of the above
B. 7
In which exon does the open reading frame start?
A. 1
B. 2
C. 3
D. 4
E. None of the above
C. 3
The DNA sequence shown comes from part of the TP53 gene. It encodes the last amino acids of the p53 protein, which is normally 393 amino acids long. The bracketed codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene.
…TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3’ …AAGTTCTGTCTTCCCGGACTGAGTCTGACTGTAAGAGG–5’
Which stop codon is used for this gene?
A. UAA
B. UAG
C. UGA
…TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3’ …AAGTTCTGTCTTCCCGGACTGAGTCTGACTGTAAGAGG–5’
C. UGA
In order to metastasize, cancer cells must break away from the tissue they were originally associated with. Loss of function of which of the following adhesions would most likely allow cancer cells to metastasize?
A. Adherens junctions
B. Gap junctions
C. Hemidesmosomes
D. Tight junctions
A. Adherens junctions
If you wanted to study how an E-cadherin mutation relates to the progression and metastasis of cancer in humans, which model organism could you use? Discuss with a neighbor and justify you selection.
A. Yeast
B. Worm
C. Fly
D. Zebrafish
E. Mice
E. Mice
Consider the genome browser data associated with TP53. Do any of these tracks provide biochemical evidence for functionality?
A. Track A – Layered H3K27Ac histone acetylation
B. Track B – Conservation among 100 vertebrates
C. Track C – Conservation among selected vertebrates
D.More than one of the above
E. None of the above
A. Track A – Layered H3K27Ac histone acetylation
Which arrow points to a transcribed region of the genome?
B.
Which arrow points to a region of the genome with functionality supported by biochemical evidence?
A.
Consider the genome browser data associated with TP53. Do any of these tracks provide genetic evidence for functionality?
A. Track A – Layered H3K27Ac histone acetylation
B. Track B – Conservation among 100 vertebrates
C. Track C – Conservation among selected vertebrates
D.More than one of the above
E. None of the above
E. None of the above
You are studying the function of two different noncoding regions of the genome. You conduct a reporter assay to test how these regions affect expression of GFP and you obtain the results shown below.
Which of the following is an appropriate control for this experiment?
A. Region 1 serves as the control
B. Region 2 serves as the control
C. Testing a third region (Region 3) would serve as the control
D. Testing GFP expression for the GFP gene alone would serve as the control
E. What is a control?
D. Testing GFP expression for the GFP gene alone would serve as the control
You are studying the function of two different noncoding regions of the genome. You conduct a reporter assay to test how these regions affect expression of GFP and you obtain the results shown below.
Which region(s) is (are) supported by genetic evidence of functionality?
A. Region 1
B. Region 2
C. Both Region 1 and 2
D. Neither Region 1 nor 2
A. Region 1
Which CRM(s) are supported by biochemical, genetic, and evolutionary evidence of functionality?
A. CRM A
B. CRM B
C. CRM C
D. More than one
E. None of them
C. CRM C
Follow-up: Why might you see different evidence for the three different CRMs?
The GATA1 binding data shown here was measured in adult blood cells. CRM B is an enhancer for HBG1 and HBG2. How would you expect GATA1 binding to CRM B to compare in fetal blood cells compared to adult blood cells?
A. Higher
B. Lower
C. About the same
A. Higher
True or False:
All protein-coding regions of the genome have genetic, evolutionary, and biochemical evidence supporting their function.
False
The percentage of the genome supported by evolutionary and genetic evidence is _______ the percentage of the genome supported by high biochemical evidence.
A. Greater than
B. Less than
C. About the same as
B. Less than
