Lecture 5 Flashcards
Draw the general formula for an amino acid. What is it that distinguishes the 20 amino acids known to exist in proteins?
H2N-CHR-COOH
R distinguishes the amino acids
a. Anemia is observed.
b. The shape of the oxygen-binding site is altered.
c. An incorrect codon is transcribed into hemoglobin mRNA.
d. The ovum (female gamete) receives a high radiation dose.
e. An incorrect codon is generated in the DNA of the hemoglobin gene.
f. A mother (an X-ray technician) accidentally steps in front of an operating X-ray generator.
g. A child dies.
h. The oxygen-transport capacity of the body is severely impaired.
i. The tRNA anticodon that lines up is one of a type that brings an unsuitable amino acid.
j. Nucleotide-pair substitution occurs in the DNA of the gene for hemoglobin.
f. A mother (an X-ray technician) accidentally steps in front of an operating X-ray generator.
d. The ovum (female gamete) receives a high radiation dose.
j. Nucleotide-pair substitution occurs in the DNA of the gene for hemoglobin.
e. An incorrect codon is generated in the DNA of the hemoglobin gene.
c. An incorrect codon is transcribed into hemoglobin mRNA.
i. The tRNA anticodon that lines up is one of a type that brings an unsuitable amino acid.
b. The shape of the oxygen-binding site is altered.
h. The oxygen-transport capacity of the body is severely impaired.
a. Anemia is observed.
g. A child dies
In vitro translation systems have been developed in which specific RNA molecules can be added to a test tube containing a bacterial cell extract that includes all the components needed for translation (ribosomes, tRNAs, amino acids). If a radioactively labeled amino acid is included, any protein translated from that RNA can be detected and displayed on a gel. If a eukaryotic mRNA is added to the test tube, would radioactive protein be produced? Explain.
Initiation of translation in prokaryotes requires specific base-pairing between the 3′ end of the 16s rRNA and a Shine–Dalgarno sequence found in the 5′ untranslated region of the mRNA. A Shine–Dalgarno sequence would not be expected (unless by chance) in a eukaryotic mRNA, and therefore initiation of translation would not occur.
Explain why antibiotics that bind the large ribosomal subunit, such as erythromycin and Zithromax, do not harm us.
Antibiotics need to selectively target bacterial structures and functions that are essential for life but unique or sufficiently different from the equivalent structure and functions of their animal hosts. The large bacterial ribosomal subunit fits these criteria as its function is obviously essential yet its structure is sufficiently different from the large eukaryotic ribosomal subunit. While the steps of protein synthesis are similar overall, eukaryotic ribosomes have larger and more numerous components. These differences make it possible to develop drugs that specifically bind bacterial ribosomes but have little or no affinity for eukaryotic ribosomes.
Describe the types of RNAs participating in translation.
1) Messenger RNA (mRNA) is encoded by distinct nuclear genes and carries the codon sequence to define synthesis of a functional protein.
2) Transfer RNAs (tRNA) carry an anticodon that interacts with a specific mRNA codon. tRNAs are charged with a specific amino acid, depending on the identify of the tRNA and its anticodon sequence.
3) Ribosomal RNAs (rRNA) are structural components of ribosomes and are a participant in the catalysis of peptide bond formation.
How are tRNAs linked to their corresponding amino acids?
Each of the 20 different amino acids that are commonly found in proteins has a corresponding aminoacyl-tRNA synthetase that covalently links the amino acid to the correct tRNA molecule.
How is the reading frame of a nucleotide sequence set?
The initiation codon on the mRNA sets the reading frame.
How does the process of initiation differ in bacterial and eukaryotic cells?
Bacterial initiation of translation requires that sequences in the 16S rRNA of the small ribosomal subunit bind to the mRNA at the ribosome binding site or the Shine–Dalgarno sequence. The Shine–Dalgarno sequence is essential in placing the ribosome over the start codon (typically AUG). In eukaryotes, there is no Shine–Dalgarno sequence. The small ribosomal subunit recognizes the 5’ cap of the eukaryotic mRNA with the assistance of initiation factors. Next, the ribosomal small subunit migrates along the mRNA scanning for the AUG start codon. In eukaryotes, the start codon is located with a consensus sequence called the Kozak sequence (5’–ACCAUGG–3’). Transcription in eukaryotes also requires more initiation factors.
What events bring about the termination of translation?
The process of termination begins when a ribosome encounters a termination codon. Because the termination codon would be located at the A site, no corresponding tRNA will enter the ribosome. This allows for the release factors (RF-1, RF-2, and RF-3) to bind the ribosome. RF-1 recognizes and interacts with the stop codons UAA and UAG, while RF-2 can interact with UAA and UGA. A RF-3-GTP complex binds to the ribosome. Termination of protein synthesis is complete when the polypeptide chain is cleaved from the tRNA located at the P site.
A nontemplate strand on bacterial DNA has the following base sequence. What amino acid sequence will be encoded by this sequence?
5´–GCGATCCATATGATACTAAGGCCC–3´
To determine the amino acid sequence, we need to know the mRNA sequence and the codons present. The nontemplate strand of the DNA has the same sequence as the mRNA, except that thymine-containing nucleotides are substituted for the uracil-containing nucleotides. So the mRNA sequence would be as follows:
5’–GCGAUGGAUAUGAUACUAAGGCCC–3’.
Assuming that the AUG indicates a start codon, then the amino acid sequence would be starting from the amino end of the peptide and ending with the carboxyl end:
N- Met-Ile–Leu–Arg–Pro-C
The following diagram illustrates a step in the process of translation. Identify the following elements on the diagram.
a. 5′ and 3′ ends of the mRNA
b. A, P, and E sites
c. Start codon
d. Stop codon
e. Amino and carboxyl ends of the newly synthesized polypeptide chain
f. Approximate location of the next peptide bond that will be formed
g. Place on the ribosome where release factor 1 will bind
Refer to picture.
Which will be most immediately affected by deleting the sequences mentioned: Replication, Transcription, RNA processing, translation?
a. ori site
b. 3’ splice site consensus sequence
c. poly(A) tail
d. terminator
e. start codon
f. -10 consensus sequence
g. Shine-Dalgarno sequence
A. REPLICATION The ori site or origin of replication is necessary for the initiation of replication.
B. RNA PROCESSING The 3’ splice site is necessary for proper excision of the intron. Therefore, RNA processing events will be affected.
