Lecture 4

Question 1

What are some characteristics of introns?

Answer 1

Introns are intervening sequences that typically do not encode proteins. Eukaryotic genes commonly contain introns. However, introns are rare in bacterial genes. The number of introns found in an organism’s genome is typically related to complexity— more complex organisms possess more introns.

Question 2

Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene contains three exons. Identify the following items and, for each item, give a brief description of its function: 
A. 5' untranslated region
B. Promoter
C. AAUAAA consesus sequence
D. Transcription site
E. 3' untranslated region
F. Introns
G. Exons
H. Poly(A) tail
I. 5' cap

Answer 2

a. 5′ untranslated region
Solution: The 5′ untranslated region lies upstream of the translation start site. The eukaryotic ribosome binds at the 5′ cap of the mRNA molecule and scans to the first methionine codon (AUG). The region 5′ of this start codon is the 5′ UTR.
b. Promoter
Solution: The promoter is the DNA sequence that the transcription apparatus recognizes and binds to initiate transcription.
c. AAUAAA consensus sequence
Solution: The AAUAAA consensus sequence lies near the 3′ end of the pre-mRNA. It determines the location of the 3′ cleavage and poly(A) tail addition to the premRNA molecule.
d. Transcription start site
Solution: The transcription start site is the location of the first transcribed nucleotide of the mRNA and is located 25 to 30 nucleotides downstream of the TATA box.
e. 3′ untranslated region
Solution: The 3′ untranslated region is a sequence of nucleotides at the 3′ end of the mRNA that is not translated into proteins. However, it does affect the translation of the mRNA molecule as well as the stability of the mRNA.
f. Introns
Solution: Introns are noncoding sequences of DNA that intervene within coding regions of a gene.
g. Exons
Solution: Exons are transcribed regions that are not removed in intron processing. They include the 5′ UTR, coding regions that are translated into amino acid sequences, and the 3′ UTR.
h. Poly(A) tail
Solution: A poly(A) tail is added to the 3’ end of the pre-mRNA. It affects mRNA stability.
i. 5′ cap
Solution: The 5′ cap functions in the initiation of translation and mRNA stability.

Question 3

Are the 5′ untranslated regions (5′ UTR) of eukaryotic mRNAs encoded by sequences in the promoter, exon, or intron of the gene? Explain your answer.

Answer 3

The 5′ UTR is located in the first exon of the gene. It is not part of the promoter because promoters for RNA polymerase II (which transcribes pre-mRNA) are not normally transcribed, and the 5′ UTR is in the mRNA. It is not located in an intron because introns are removed during processing of pre-mRNA, and the 5′ UTR is part of the mRNA.

Question 4

A human gene was initially identified as having three exons and two introns. The exons are 456, 224, and 524 bp, whereas the introns are 2.3 kb and 4.6 kb.

a. Draw this gene, showing the promoter, introns, exons, and transcription start and stop sites.
b. This gene is found to encode not one but two mRNAs. The original mRNA is 1204 nucleotides, and the new mRNA is 680 nucleotides. How is this possible?

Answer 4

b. Alternative splicing of the primary transcript would result in mRNAs that differ in the number of nucleotides they contain. The original mRNA includes all three exons, while the second transcript only includes the first and second exon.

Question 5

A research group has sequenced the cDNA and genomic DNA from a particular gene. The cDNA is derived from mRNA, so it does not contain introns. Here are the DNA sequences:
cDNA:
5’ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTATCACCCAACTCGGTTACCTACTAGTATATCCCATATACTAGCATATATTTTACCCATAATTTGTGTGTGGGTATACAGTATAATCATATA-3’
Genomic DNA (contains one intron):
5’ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTATCACCCAACTCGGCCCACCCCCCAGGTTTACACAGTCATACCATACATACAAAAATCGCAGTTACTTATCCCAAAAAAACCTAGATACCCCACATACTAATAACTCTTTCTTTCTAGGTTACCTACTAGTATATCCCATATACTAGCATATATTTTACCCATAATTTGTGTGTGGGTATACAGTATAATCATATA-3’
Indicate where the intron is located. Does the intron contain the normal consensus splice site sequences? Underline the splice site sequences, and indicate whether or not they fit the consensus sequence.

Answer 5

5’ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTATCACCCAACTCGstartYellowGCCCACCCCCCAGGTTTACACAGTCATACCATACATACAAAAATCGCAGTTACTTATCCCAAAAAAACCTAGATACCCCACATAendYellow_startBlueCTATTendBlue_startYellowAACTCTTTCTTTCTAGendYellow5’ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTATCACCCAACTCGGCCCACCCCCCAGGTTTACACAGTCATACCATACATACAAAAATCGCAGTTACTTATCCCAAAAAAACCTAGATACCCCACATACTATTAACTCTTTCTTTCTAGGTTACCTACTAGTATATCCCATATACTAGCATATATTTTACCCATAATTTGTGTGTGGGTATACAGTATAATCATATA-3’

Yellow indicates the location of the intron. The intron contains the normal consensus splice site sequences for the 3’ end of the intron containing an AG at the end of the intron, while the 5’ end of the intron normally contains a GU (GT), in this case the 5’ end of the intron contains a GC instead. A common branch site sequence in eukaryotes is CTAAT with the middle A being the branch site. This sequence is normal within this intron for the branch site (in blue).

Question 6

In the electron micrograph below are the RNA polymerase molecules moving from right to left or from left to right? How can you tell? Why do the RNA transcripts appear so much shorter than the length of DNA that encodes them?

Answer 6

The RNA polymerase molecule is moving from left to right transcribing in the 5’ to 3’ direction. As the transcription complex moves along the gene the RNA product gets longer. There are many transcription complexes transcribing this region at the same time. The RNA transcripts appear shorter than the DNA because the RNA is bound to proteins, which are compacting them.

Question 7

Smilin is a (hypothetical) protein that causes people to be happy. It is inactive in many chronically unhappy people. The mRNA isolated from a number of different unhappy individuals in the same family was found to lack an internal stretch of 173 nucleotides that are present in the Smilin mRNA isolated from a control group of general happy people. The DNA sequences of the Smilin genes from the happy and unhappy person were determined and compared. They differed by just one nucleotide change-and no nucleotides were deleted. Moreover the change was found in an intron.
a. Can you hypothesize a molecular mechanism by which a single nucleotide change in a gene could cause the observed internal deletion in the mRNA?
b. What consequences for the Smilin protein would result from removing a 173-nucleotide-long internal stretch from its mRNA? Assume that the 173 nucleotides are deleted from the coding region of the Smilin mRNA.
What can you say about the molecular basis of unhappiness in this family?

Answer 7

a. A single nucleotide change at the 3’ splice site could cause the splicing machinery to miss this splice site and move on to recognize the 3’ splice site prior to the next exon. This would cause the splicing machinery to skip that exon and would result in in the 173-nt deletion in the mRNA.
b. The consequence of removing a 173-nucleotide long internal stretch in the mRNA would result in the production of a different protein than the normal full-length protein. This protein is likely not functional or less functional than the full-length protein.
c. You need a full-length copy of the Smilin protein to be happy and the deletion of the one exon in the protein results in the protein being non-functional or less functional and therefore results in unhappy people.

Question 8

Transcription, replication, both, or neither?

The new strand is made 5’ to 3’

Answer 8

both

Question 9

Transcription, replication, both, or neither?

The new strand is made 3’ to 5’

Answer 9

neither

Question 10

Transcription, replication, both, or neither?

The new strand is identical to the template strand, with the exception of Us replacing Ts

Answer 10

neither

Question 11

Transcription, replication, both, or neither?

The new strand is complementary to the template strand

Answer 11

both

Question 12

Transcription, replication, both, or neither?

the template strand is RNA

Answer 12

neither

Question 13

Transcription, replication, both, or neither?

The product is DNA

Answer 13

Replication

Question 14

Transcription, replication, both, or neither?

The product is RNA

Answer 14

Transcription

Question 15

Transcription, replication, both, or neither?

An RNA primer is required to initiate synthesis

Answer 15

Replication

Question 16

Transcription, replication, both, or neither?

Synthesis of the new strand is initiated at a promoter

Answer 16

Transcription

Question 17

Transcription, replication, both, or neither?

The process is done only during the S-phase of the cell

Answer 17

Replication

Question 18

Transcription, replication, both, or neither?

The process is done only during the G1-phase of the cell cycle

Answer 18

neither

Question 19

Suppose that you have sequenced five genes, including the putative promoter region of each gene, that are involved in the cold acclimation process in Arabidopsis. Each of the five genes is expressed only when the temperature falls below a certain temperature. You know that a specific transcription factor (CBF1) binds somewhere between –200 and –250 of these genes to initiate transcription. How could you use the sequences to determine the DNA sequence motif that is bound by CBF1?

Answer 19

Align the five sequences and look for a consensus sequence. This could be the desired sequence. To further test this hypothesis, mutate the sequence and see if the mutation prevents CBF1 from binding to it and initiating transcription under the inducing condition (cold temperature).

Question 20

Name the three major modifications of mRNA in eukaryotes before it is transported to the cytoplasm. In addition, tell why each of the modifications is necessary

Answer 20

1) Add 5′ cap to protect against RNA degradation and to act as a binding site for the initiation of translation;
2) add poly-A tail to the 3′ end of the transcript to protect against degradation and aid in the transfer of the mRNA to the cytoplasm; and
3) remove introns to generate an intact open reading frame for translation.

Question 21

. A geneticist induces a mutation in a cell line growing in the laboratory. The mutation occurs in a gene that encodes a protein that participates in the cleavage and polyadenylation of eukaryotic mRNA. What will be the immediate effect of this mutation on RNA molecules in the cultured cells?

Answer 21

The protein is needed as part of the process for cleavage of the 3′ UTR and for polyadenylation. A nonfunctional protein would result in mRNA lacking a poly(A) tail, and the mRNA would be degraded more quickly in the cytoplasm by nucleases.

Question 22

Elaborate repair mechanisms are associated with replication to prevent permanent mutations in DNA, yet no similar repair is associated with transcription. Can you think of a reason for this difference in replication and transcription? (Hint: Think about the relative effects of a permanent mutation in a DNA molecule compared with one in an RNA molecule.)

Answer 22

RNA molecules are constantly being synthesized, subsequently degraded, and then resynthesized. As such a defective RNA molecule would soon be replaced and would only briefly affect a cell. Furthermore, the defective RNA would not be passed to offspring of that cell. DNA mutations, however, are permanent. All RNAs transcribed from that gene would be affected by a change in the DNA sequence. The mutation in the DNA molecule would be passed to progeny cells and propagated. Finally, replication occurs only once during the cell cycle. Once the mutation occurs, there is no subsequent replication that could produce the correct sequence. Mutations can only be corrected through repair mechanisms or back mutations.