Introduction to Biological Molecules 1 & 2

Question 1

Describe the structure of DNA

Answer 1

DNA is a polymer of deoxyribosenucleotides, it forms a double stranded molecule that is an antiparallel double helix.

Question 2

What are the four nucleotides found in DNA?

Answer 2

Two Purine: Adenine and Guanine

Two Pyrimidines: Cytosine and Thymine

Question 3

Describe the bonding between the base pairs

Answer 3

With A binding too T and C to G via hydrogen bonds. A to T forming two hydrogen bonds and C to G forming three hydrogen bonds.

Question 4

Describe the Polarity of DNA

Answer 4

The orientation of the 3′ and 5′ carbons along the sugar-phosphate backbone confers directionality (sometimes called polarity) to each DNA strand.

Question 5

How is DNA packaged into the cell?

Answer 5

DNA is wrapped around histone proteins which form nuclosomes, which are further wound up tightly until they are condensed into chromatin. This can be further coiled up till it forms chromosomes. The ends of chromosomes are called telomeres

Question 6

Describe some of the features of histone proteins

Answer 6

They are positively charged making them attracted to negatively charged DNA and they have long N-termini, these amino terminals protrude from the nucleosomes.

Question 7

Describe the function of Histone H1

Answer 7

It tells the DNA as it comes off the first nucleosome which way to wrap around the second so that it doesn’t unravel.

“It helps maintain the direction of twisting”

Question 8

What is the function of DNA scaffolding

Answer 8

To further condense DNA

Question 9

Draw the structure of chromosome and chromatin

Answer 9

Basically chromatin is the DNA wrapped around histone proteins and a chromasome is lots of squiggles

Question 10

Why must chromosomes be remodelled?

Answer 10

To allow proteins to access the DNA

Question 11

What are interspersed repeated?

Answer 11

A sequence that can appear in different places in the genome but is essentially is the same sequence.

They can be Short Interspersed Nuclear Elements (SINE) or Long Interspersed Nuclear Elements (LINE)

Question 12

What are tandem repeates

Answer 12

Sequences that are repeated immediately adjacent to each other e.g. TTCAGTTCAGTTCAGTTCAG

Question 13

What is repeating DNA important in?

Answer 13

It can be used forensics and in the diagnosis of myotonic dystrophy

Question 14

What is semi-conservative replication?

Answer 14

It is where each daughter molecule consists of one old (template) strand and one newly synthesised strand

Question 15

What allows for faster DNA replication?

Answer 15

DNA replication is initiated at many different sites simultaneously

Question 16

In what directions is DNA synthesised?

Answer 16

In a 5’ to 3’ direction

Question 17

Describe DNA synthesis in the lagging strand

Answer 17

DNA helicase unwinds parental DNA, the primase becomes activated and synthesises a short RNA primer on the lagging strand. DNA polymerase binds to the DNA strand and is locked in by the clamp. It uses the primer to begin a short copy of the lagging strand DNA. The polymerase stalls as it reaches the RNA primer of the proceeding okazaki fragment. Clamp that keeps the lagging strand attached to the DNA polymerase dissociates. DNA polymerase temporarily releases the lagging strand of DNA and the process repeates.

Question 18

How can errors in DNA synthesis be removed?

Answer 18

By DNA polymerase that have a proof reading function which can remove errors pre-replication. And mutations can be reomved post-replications via mismatch repair. Both of these mechanisms are highly reliable in removing errors

Question 19

What occurs when there is a defect in mismatch repair pathways?

Answer 19

It can make individuals pre-disposed to certain diseases such as cancer.

Question 20

Describe the process of polymerase chain reaction (PCR)

Answer 20

The region of double-stranded DNA that is being amplified is heated to separate strands.
It is then cooled and primers are added which bind to specific sequences.
Heat resistant DNA polymerases are added along with nucleotides and the DNA is the synthesised.

Question 21

What are some clinical scenarios where PCR is used

Answer 21

To investigate the presence of infectious agents and inheritance patterns

Question 22

Describe how DNA sequencing works?

Answer 22

The strand of DNA is separated by heating and then cooled. A labeled primer and an excess amount of nucleotides are added.
In separate test tubes, ddATP, ddTTP, ddGTP and ddCTP are added to the DNA mix along with DNA polymerase. The solutions are place in a machine that separated things by length, then the DNA sequence can be found

Question 23

Give a example when DNA sequencing is used in a clinical setting

Answer 23

When look for sequences that give rise to mutations