Introduction to Biological Molecules 1 & 2 Flashcards
Describe the structure of DNA
DNA is a polymer of deoxyribosenucleotides, it forms a double stranded molecule that is an antiparallel double helix.
What are the four nucleotides found in DNA?
Two Purine: Adenine and Guanine
Two Pyrimidines: Cytosine and Thymine
Describe the bonding between the base pairs
With A binding too T and C to G via hydrogen bonds. A to T forming two hydrogen bonds and C to G forming three hydrogen bonds.
Describe the Polarity of DNA
The orientation of the 3′ and 5′ carbons along the sugar-phosphate backbone confers directionality (sometimes called polarity) to each DNA strand.
How is DNA packaged into the cell?
DNA is wrapped around histone proteins which form nuclosomes, which are further wound up tightly until they are condensed into chromatin. This can be further coiled up till it forms chromosomes. The ends of chromosomes are called telomeres
Describe some of the features of histone proteins
They are positively charged making them attracted to negatively charged DNA and they have long N-termini, these amino terminals protrude from the nucleosomes.
Describe the function of Histone H1
It tells the DNA as it comes off the first nucleosome which way to wrap around the second so that it doesn’t unravel.
“It helps maintain the direction of twisting”
What is the function of DNA scaffolding
To further condense DNA
Draw the structure of chromosome and chromatin
Basically chromatin is the DNA wrapped around histone proteins and a chromasome is lots of squiggles
Why must chromosomes be remodelled?
To allow proteins to access the DNA
What are interspersed repeated?
A sequence that can appear in different places in the genome but is essentially is the same sequence.
They can be Short Interspersed Nuclear Elements (SINE) or Long Interspersed Nuclear Elements (LINE)
What are tandem repeates
Sequences that are repeated immediately adjacent to each other e.g. TTCAGTTCAGTTCAGTTCAG
What is repeating DNA important in?
It can be used forensics and in the diagnosis of myotonic dystrophy
What is semi-conservative replication?
It is where each daughter molecule consists of one old (template) strand and one newly synthesised strand
What allows for faster DNA replication?
DNA replication is initiated at many different sites simultaneously
In what directions is DNA synthesised?
In a 5’ to 3’ direction
Describe DNA synthesis in the lagging strand
DNA helicase unwinds parental DNA, the primase becomes activated and synthesises a short RNA primer on the lagging strand. DNA polymerase binds to the DNA strand and is locked in by the clamp. It uses the primer to begin a short copy of the lagging strand DNA. The polymerase stalls as it reaches the RNA primer of the proceeding okazaki fragment. Clamp that keeps the lagging strand attached to the DNA polymerase dissociates. DNA polymerase temporarily releases the lagging strand of DNA and the process repeates.
How can errors in DNA synthesis be removed?
By DNA polymerase that have a proof reading function which can remove errors pre-replication. And mutations can be reomved post-replications via mismatch repair. Both of these mechanisms are highly reliable in removing errors
What occurs when there is a defect in mismatch repair pathways?
It can make individuals pre-disposed to certain diseases such as cancer.
Describe the process of polymerase chain reaction (PCR)
The region of double-stranded DNA that is being amplified is heated to separate strands.
It is then cooled and primers are added which bind to specific sequences.
Heat resistant DNA polymerases are added along with nucleotides and the DNA is the synthesised.
What are some clinical scenarios where PCR is used
To investigate the presence of infectious agents and inheritance patterns
Describe how DNA sequencing works?
The strand of DNA is separated by heating and then cooled. A labeled primer and an excess amount of nucleotides are added.
In separate test tubes, ddATP, ddTTP, ddGTP and ddCTP are added to the DNA mix along with DNA polymerase. The solutions are place in a machine that separated things by length, then the DNA sequence can be found
Give a example when DNA sequencing is used in a clinical setting
When look for sequences that give rise to mutations
