Exam 6 Flashcards
(Exam 6) __________ is not processed prior to translation.
-Prokaryotic mRNA
-Eukaryotic tRNA
-Prokaryotic tRNA
-Eukaryotic mRNA
-Eukaryotic rRNA
-Prokaryotic mRNA
(Exam 6) When the first and second nucleotides are methylated, we refer to the 5’ cap as:
-Cap-1
-Cap-2
-Cap-2
(Exam 6)The transcriptional termination signal in eukaryotes, AAUAAA, is recognized and bound by:
-Poly A Polymerase
-Cleavage/Polyadenylation Specificity Factor
-Cleavage Factor I
-Cleavage Factor II
-Cleavage Stimulation Factor
-Cleavage/Polyadenylation Specificity Factor
(Exam 6) ________ is the first SnRNP to recognize and bind to the branch point.
-SnRNP U1
-SnRNP U2
-SnRNP U4
-SnRNP U5
-SnRNP U6
-SnRNP U2
(Exam 6) A CGG codon is mutated to AGG. This is an example of:
-Missense mutation (or non-synonymous)
-Sense mutation (or synonymous mutations)
-Sense mutation (or synonymous mutations)
(Exam 6) For this question, please refer to the follow mRNA sequence:
ACCGGAUAUUGACGCUACUG
The third codon in reading frame 3 (RF3) encodes for:
-Leucine (Leu, L)
-Isoleucine (Iso, I)
-Valine (Val, V)
-Serine (Ser, S)
-Stop codon (Termination codon)
-Leucine (Leu, L)
(Exam 6) When found in the anticodon, 5’ UGA 3’ can form Wobble interactions with (please note the direction of the anticodons and anticodon):
-5’ UCG 3’
-5’ UCA 3
-5’ UCG 3’
(Exam 6) The substrates for amino acyl-tRNA synthestases are:
-an amino acid and tRNA
-two amino acids and tRNA
-an amino acid, ATP, and tRNA
-an amino acid, GTP, and tRNA
-Amino acyl-tRNA and Peptidyl-tRNA
-an amino acid, ATP, and tRNA
(Exam 6) A frameshift mutation will result in:
-a change of one amino acid to a different amino acid.
-a change of one amino acid encoding codon to a stop codon.
-a change to an amino acid encoding codon, but no change to the encoded amino acid.
-an insertion or deletion of one or more codons.
-a change in the sequence and length in the encoded protein sequence
-a change in the sequence and length in the encoded protein sequence
(Exam 6) The Shine Dalgarno sequence is recognized by the ________ on the small ribosomal subunit.
-16S rRNA
-18S rRNA
-16S rRNA
(Exam 6) Release factor 1 recognizes and binds to a stop codon positioned in the __________ of the ribosome.
-A site
-P site
-A site
(Exam 6) __________ binds to the 5’ cap and poly A tail to circularize mRNA.
-eIF1
-eIF2
-eIF3
-eIF4F
-eIF4A
-eIF4F
(Exam 6) n eukaryotes, __________ is recharged by __________.
-eEF-2; eEF-1βγ
-EF-G; EF-Ts
-EF-Tu; EF-Ts
-eEF-1α; eEF-1βγ
-eEF-1βγ; eEF-1α
-eEF-1α; eEF-1βγ
(Exam 6) In eukaryotes, the formation of a peptide bond is catalyzed by an adenosine residue found on the ________.
-23S rRNA
-5.8S rRNA
-18S rRNA
-16S rRNA
-28S rRNA
-28S rRNA
(Exam 6) Translocation of an unfolded protein in bacteria requires ________ as an energy source.
-ATP
-Proton (H+) pump
-ATP