Evolutionary Biology (Davide Pisani 7-9)

Question 1

In phylogenetic trees, what does the branch length represent?

Answer 1

The evolutionary distance, or time since the last common ancestor.

Question 2

What are the three types of phylogenetic groups, and what do they mean?

Answer 2

• Monophyletic = contains species derived from a unique common ancestor with respect to the rest of the tree (Clades).
• Paraphyletic = only include some descendants, it’s not a natural group. e.g. animals without humans.
• Polyphyletic = based on characteristics and isn’t actually a scientific group. e.g. winged animals.

Question 3

Why is ‘Maximum Parsimony’ useful?

Answer 3

• It provides a way to chose among alternative phylogenetic trees.
• Favours hypotheses that maximise homology and minimises homoplasy.
• based on fit
• the fit of a character to a tree= minimum number of steps/changes required to explain the observed distribution of character states among the species represented in the tree. (Note: hair trait example).

Question 4

When is Bootstrapping useful?

Answer 4

For evaluating confidence, when resampling is impossible in nature.
It uses a pseudo-dataset to make a majority-rule consensus tree.

Question 5

When looking at pairwise evolutionary distances, what two things must we assume?

Answer 5

1) the probability of change between any two nucleotides is the same.
2) the rate of substitution is the same at each site.

(Both not necessarily true!)

Question 6

What is the P distance value of these two sequences?

1) AGTTGTCCATGCGGATACGT
2) AGTTGTCCATGCTTATACGT

Answer 6

P= the number of positions at which the sequences differ (nd) / length (n)

2/20 = 0.1

Question 7

What is the significance of Zuckerkandl and Pauling’s investigation in 1965?

Answer 7

They studied proteins such as alpha-globin which can be used as molecular clocks.
- can be used to determine the divergence times without a fossil record.

Question 8

In the neutral theory of evolution, what is ‘r’?

Answer 8

r= m (the mutation rate per site, per year, for a population).

Question 9

In the neutral theory of evolution, what is ‘D’?

Answer 9

The number of substitutions accumulated by two sequences.

D= 2r*T (T= time since divergence)

(D can be approximated from P
If T is known, r can be estimated
If r is known then T can be estimated ( T=D/2r & R=D/2T)

Question 10

How did phylogenetics help in the Florida dentist case?

Answer 10

A clear ‘dental clade’ was identified; individuals had gp120 sequences similar to the dentist’s. Most likely that these individuals contracted HIV from the dentist as they had ‘low-risk’ lifestyles.