Chapter 10 Flashcards by Davesh Purohit

Which of the following is NOT a key characteristic that genetic material must possess?

a. Genetic material must contain complex information.
b. Genetic material must replicate faithfully.
c. Genetic material must encode the phenotype.
d. Genetic material must have the capacity to vary.
e. Genetic material must contain nitrogen but not sulfur.

e. Genetic material must contain nitrogen but not sulfur.

How well did you know this?

Not at all

Perfectly

Why was the idea that genes are made of nucleic acids not widely accepted until after 1950?

a. Proteins are more abundant than nucleic acids, so it seemed more logical that proteins would carry genetic information.
b. Until the structure of DNA was understood, how DNA could store and transmit genetic information was unclear.
c. Amino acids existed in the pre-biotic environment, so they would have most likely been the first to carry genetic information for life.
d. DNA was not chemically stable for long enough to be a good method of storing genetic information.
e. Nothing was known about the chemistry of DNA until after 1950.

b. Until the structure of DNA was understood, how DNA could store and transmit genetic information was unclear.

How well did you know this?

Not at all

Perfectly

How did Albert Kossel contribute to our understanding of DNA?

a. Used X-ray diffraction to examine the structure of DNA
b. Determined that DNA contains four different nitrogenous bases
c. Found that “the transforming principle” is destroyed by enzymes that hydrolyze DNA
d. Found that the phosphorus-containing components are the genetic material of phages
e. Discovered “the transforming principle” that could genetically alter bacteria

b. Determined that DNA contains four different nitrogenous bases

How well did you know this?

Not at all

Perfectly

How did Fred Griffith contribute to our understanding of DNA?

e. Discovered “the transforming principle” that could genetically alter bacteria

How well did you know this?

Not at all

Perfectly

How did Avery, MacLeod, and McCarty contribute to our understanding of DNA?

e. Discovered “the transforming principle” that could genetically alter bacteria

How well did you know this?

Not at all

Perfectly

How did Rosalind Franklin contribute to our understanding of DNA?

a. Used X-ray diffraction to show that the structure of DNA is helical
b. Determined that DNA contains four different nitrogenous bases
c. Found that “the transforming principle” is destroyed by enzymes that hydrolyze DNA
d. Found that the phosphorus-containing components are the genetic material of phages
e. Discovered “the transforming principle” that could genetically alter bacteria

a. Used X-ray diffraction to show that the structure of DNA is helical

How well did you know this?

Not at all

Perfectly

How did Alfred Hershey and Martha Chase contribute to our understanding of DNA?

d. Found that the phosphorus-containing components are the genetic material of phages

How well did you know this?

Not at all

Perfectly

Indicate which of the following statements is FALSE.

a. Covalent bonds connect nucleotides in a strand; noncovalent interactions hold strands into a double-stranded structure.
b. Uracil is similar to thymine except that uracil lacks a methyl group on the carbon at position 5 on the carbon-nitrogen ring.
c. Frederick Griffith demonstrated that a transforming chemical from dead bacteria could change the genetic information of living bacteria.
d. Avery, MacLeod, and McCarty showed that DNA is the genetic information of cells and that RNA is the genetic information of viruses.
e. The pyrimidine bases in nucleic acids are cytosine, thymine, and uracil.

d. Avery, MacLeod, and McCarty showed that DNA is the genetic information of cells and that RNA is the genetic information of viruses.

How well did you know this?

Not at all

Perfectly

Which hypothesis contributed to the idea that protein is the genetic material because, with its 20 different amino acids, protein structure could be highly variable?

a. Tetranucleotide hypothesis
b. Central dogma hypothesis
c. RNA world hypothesis
d. One gene-one enzyme hypothesis
e. Adaptor hypothesis

a. Tetranucleotide hypothesis

How well did you know this?

Not at all

Perfectly

The following table shows Chargaff’s data that demonstrates base composition of DNA from different biological sources.
Source    A        T        G          C
E. coli    26.0   23.9   24.9    25.2
Yeast     31.3    32.9   18.7      17.1
Sea 
urchin    32.8  32.1     17.7      18.4
Rat         28.6   28.4   21.4     21.5
Human  30.3   30.3   19.5      19.9

Which of the following is NOT a general conclusion that is supported by these data?

a. DNA consists of a series of four-nucleotide units, each containing all four bases—ATGC—in a fixed sequence.
b. The amount of adenine is always equal to the amount of thymine.
c. The amount of guanine is always equal to the amount of cytosine.
d. Although the ratio of A/T and G/C is the constant, relative amount of any particular base varies between species.
e. (A + G) / (T + C) = 1

a. DNA consists of a series of four-nucleotide units, each containing all four bases—ATGC—in a fixed sequence.

How well did you know this?

Not at all

Perfectly

Hershey and Chase determined whether DNA or protein was the genetic material in bacteriophages. What isotope did they use to label the viral DNA?

a. 14C
b. 15N
c. 18O
d. 32P
e. 35S

e. 35S

How well did you know this?

Not at all

Perfectly

Hershey and Chase determined whether DNA or protein was the genetic material in bacteriophages. What isotope did they use to label the viral protein?

a. 14C
b. 15N
c. 18O
d. 32P
e. 35S

e. 35S

How well did you know this?

Not at all

Perfectly

What is the difference in hydrogen bonding between A/T pairs versus G/C pairs?

a. A/T pairs have one more hydrogen bond than G/C pairs.
b. G/C pairs have one more hydrogen bond than A/T pairs.
c. A/T pairs have two more hydrogen bonds than G/C pairs.
d. G/C pairs have two more hydrogen bonds than A/T pairs.
e. G/C pairs have three more hydrogen bonds than A/T pairs.

b. G/C pairs have one more hydrogen bond than A/T pairs.

How well did you know this?

Not at all

Perfectly

Heat can disrupt hydrogen bonding between DNA strands. Which of the following DNA strands would denature at the highest temperature?

a. a.10% AT and 90% GC
b. b.30% AT and 70% GC
c. c.50% AT and 50% GC
d. d.70% AT and 30% GC
e. e.90% AT and 10% GC

a. a.10% AT and 90% GC

How well did you know this?

Not at all

Perfectly

Heat can disrupt hydrogen bonding between DNA strands. Which of the following DNA strands would denature at the lowest temperature?

a. 10% AT and 90% GC
b. 30% AT and 70% GC
c. 50% AT and 50% GC
d. 70% AT and 30% GC
e. 90% AT and 10% GC

e. 90% AT and 10% GC

How well did you know this?

Not at all

Perfectly

The concept that genetic information passes from DNA to RNA to protein is called the

a. central dogma.
b. nitrogenous base.
c. transforming principle.
d. polynucleotide strand.
e. reverse transcription.

a. central dogma.

A molecule that consists of a nitrogenous base bonded to the 1′ carbon of a ribose or deoxyribose is a(n)

a. nucleoside.
b. hairpin.
c. isotope.
d. polynucleotide.
e. nucleotide.

a. nucleoside.

The bonds that connect nucleotides in a single strand are called ____________ bonds.

a. phosphodiester
b. peptide
c. ionic
d. hydrogen
e. glycosidic

a. phosphodiester

With respect to their 3′ and 5′ ends, the two polynucleotide chains of a double-stranded DNA molecule are

a. antiparallel.
b. isotopes.
c. methylated.
d. complementary.
e. nitrogenous.

a. antiparallel.

Indicate which of the following statements is TRUE.

a. There are three phosphates between each sugar in a molecule of DNA.
b. A-, B-, and Z-form DNA are all right-handed helixes.
c. There are three hydrogen bonds between AT pairs.
d. Ribose sugars have a hydroxyl on the 2′ carbon.
e. All organisms contain DNA that is roughly 25% A, 25% T, 25% G, and 25%

d. Ribose sugars have a hydroxyl on the 2′ carbon.

Which of the following is NOT characteristic of A-form DNA compared to B- or Z-form DNA?

a. Has right-handed helixes
b. Exists when less water is present
c. Is long and narrow
d. Has 50% purines, 50% pyrimidines

c. Is long and narrow

If a DNA molecule is 30% cytosine (C), what is the percentage of guanine (G)?

a. 30%
b. 60%
c. 35%
d. 70%
e. 15%

a. 30%

ADNA molecule of 50 base pairs contains 15 cytosine bases (C), how many thymine bases will it have?

a. 10
b. 15
c. 30
d. 35
e. 60

d. 35

If the sequence of one strand of DNA is 5′-GCTAGCGTCG-3′, what is the sequence of the complementary strand?

a. 3′-GCTAGCGTCG-5′
b. 5′-GCTGCGATCG-3′
c. 3′-CGATCGCAGC-5′
d. 5′-CGATCGCAGC-3′
e. 5′-CGAUCGCAGC-3′

c. 3′-CGATCGCAGC-5′

Which of the following would NOT necessarily be true for a DNA molecule? a. A = T b. C = G c. A + G = C + T d. A + C = G + T e. A + T = G + C

e. A + T = G + C

Which of the following is not an example of secondary structure in nucleic acids? a. Hairpin b. Stem c. H-DNA d. B-DNA e. C-DNA

e. C-DNA

What type of secondary structure is formed by the pairing of three strands of DNA? a. A-DNA b. B-DNA c. C-DNA d. H-DNA e. Z-DNA

d. H-DNA

Which of these sequences could form a hairpin? a. 5′-GGGGTTTTCCCC-3′ b. 5′-AAAAAAAAAAAA-3′ c. 5′-ACACACACACAC-3′ d. 5′-TTTTTTCCCCCC-3′ e. 5′-GGGTTTGGGTTT-3′

a. 5′-GGGGTTTTCCCC-3′

Which of the following is not a chemical or structural characteristic of RNA that is different from those of DNA? a. The RNA sugar is ribose instead of deoxyribose. b. RNA is usually a single-stranded molecule instead of a hydrogen-bonded double strand like DNA. c. The bases in RNA include uracil instead of thymine. d. RNA molecules are generally shorter in length than those of DNA macromolecules. e. The 2′ carbon of ribose has an H, unlike the OH in that position of deoxyribose.

e. The 2′ carbon of ribose has an H, unlike the OH in that position of deoxyribose.

How many hydrogen bonds will be involved in base pairing in a DNA molecule of 50 base pairs that contains 15 cytosine bases? a. 45 b. 100 c. 115 d. 135 e. 150

c. 115

List three characteristics required of genetic material. For each characteristic, indicate how the structure of DNA helps us to understand the characteristic.

Genetic material must have the capacity to contain enough information to encode all the functions of an organism. Because DNA molecules in cells normally are very long and because the four base pairs can occur in any sequence, DNA molecules are able to store a large amount of information in the form of the sequence of nucleotide base pairs. Genetic material must have a mechanism to be copied accurately for reproduction. The double helix model of DNA suggested to Watson and Crick that DNA could be replicated by semiconservative replication. In this mechanism, the two strands of a parental molecule are separated, and each parental strand acts as a template to direct the synthesis of a new strand through complementary base pairing. Genetic material must be able to encode variable phenotypes. Changes in the sequence of base pairs in DNA (mutations) allow for the existence of different versions of genes (alleles) that can encode alternative phenotypes.

How did Chargaff’s rules contribute to Watson and Crick’s elucidation of the structure of DNA?

The rules suggested the base-pairing combinations of adenine with thymine and guanine with cytosine.

How did the work of Hershey and Chase contribute to the model of DNA as the genetic material? What technique helped them to distinguish between viral DNA and protein?

It distinguished between protein and DNA as genetic material in phages. It is the DNA that is used to produce new phages within host cells. Radioactive isotopes were used to distinguish between DNA and protein. They used radioactive 32P to label the viral DNA, and they used radioactive 35S to label the viral proteins.

Draw the complementary strand to the following single-stranded DNA and label the 5′ and 3′ ends: 5′-ATAGCATGGGCCATACGATTACTGA-3′

3′-TATCGTACCCGGTATGCTAATGACT-5′

How many of each of the following does this DNA molecule have? AATAGCGGATGCCCGAATACGAG TTATCGCCTACGGGCTTATGCTC a. 3′ hydroxyls b. Hydrogen bonds c. Purines d. Ribose sugars

a. 2 b. 58 c. 23 d. 0

What would be the sequence of a single-stranded DNA produced by using the DNA sequence shown as a template? 3′-TACCGTGCGTGACATTAAGCC-5′ Write the sequence from 5′ to 3′, left to right.

5′-ATGGCACGCACTGTAATTCGG-3′

What would be the sequence of an RNA produced by using the DNA sequence shown as a template? 3′-TACCGTGCGTGACATTAAGCC-5′ Write the sequence from 5′ to 3′, left to right.

5′-AUGGCACGCACUGUAAUUCGG-3′