Bio Final Practice Exam !

Question 1

What is the function of the release factor during translation in Eukaryotes?

Answer 1

It binds to the stop codon in the A site in place of tRNA

Question 2

Which of the following processes occurs in eukaryptic gene expression?

Answer 2

A cap is added to the 5’ end of the mRNA

Question 3

Which of the following molecules is a protein produced by a regulatory gene?

Answer 3

repressor

Question 4

In eukaryotes, there are several different types of RNA polymerase. Which type is involved in transcription of mRNA for a goblin protein?

Answer 4

RNA polymerase II

Question 5

Which of the following functions are characteristic of general transcription factors in eukaryotes?

Answer 5

They bind to other proteins or to the TATA box

Question 6

refer to the metabolic pathway pictured on the actual practice test. If A,B, and C are all required for growth, a strain that is mutant for the gene-encoding enzyme A would be able to grow on medium supplemented with which of the following nutrients?

Answer 6

either nutrient B or C

Question 7

An original section of DNA has the base sequence AGCGTTACCGT. A mutation in this DNA strand results in the base sequence AGGCGTTACCGT. What type of mutation does this change represent?

Answer 7

Frameshift mutation

Question 8

In Drosophila melanogaster, vestigial wings are determined by a recessive allele of a gene that is 8) linked to a gene with a recessive allele that determines black body color. T. H. Morgan crossed black-bodied, normal-winged females and gray-bodied, vestigial-winged males. The F1 were all
gray bodied, normal winged. The F1 females were crossed to homozygous recessive males to
produce testcross progeny. Morgan calculated the map distance to be 17 map units. Which of the following information is correct about the testcross progeny?

Answer 8

gray-bodied, normal-winged flies plus black-bodied, vestigial-winged flies = 17% of the
total

Question 9

One possible result of chromosomal breakage is for a fragment to join a nonhomologous chromosome. What is this type of chromosomal alteration called?

Answer 9

Translocation

Question 10

Which of the following statements best describes the termination of transcription in prokaryotes?

Answer 10

RNA polymerase transcribes through the terminator signals (Rho-dependent or Rho-independent), causing the polymerase to separate from the DNA and release the transcript.

Question 11

Under what conditions does the trp repressor block transcription of the trp operon?

Answer 11

when the repressor binds to tryptophen

Question 12

From left to right, human check cells, human nerve cells, human red bloods cells. Why do these three cells, taken from the same human, have different functions?

Answer 12

They have differential gene expression patterns

Question 13

Which of the following processes occur when termination of translation takes place?

Answer 13

A stop codon is reached

Question 14

The purpose of the spliceosome is to:

Answer 14

remove introns from the premature mRNA

Question 15

refer to picture on actual practice exam. Which of the following sequences of nucleotides are possible in the template strand of DNA that would code for the polypeptide sequence Phe-Leu-Ile-Val?

Answer 15

3’-AAA-GAA-TAA-CAA-5’

Question 16

Refer to the picture from the question above. Which of the triplets below is a possible anticodon for tRNA that transports proline to a ribosome?

Answer 16

3’-GGC-5’

Question 17

Below are the mature mRNA sequences of two strains of a virus: one is a normal strain and the 17)
other is a mutated strain.
Normal strain RNA: 5’ UAACCAUGAUCAUUGCUUUGAGCUACAUUUAA 3’ Mutated strain RNA: 5’ UAACCAUGAUCAUUGCUUAGAGCUACAUUUAA 3’
How many amino acids (in total ) is translated in the normal and mutated strain, respectively? Also, what kind of mutation is this? Refer to the codon table when answering this question.

Answer 17

8 and 4; nonsense mutation

Question 18

DNA methylation and histone acetylation are examples of which of the following processes?

Answer 18

epigenetic phenomena

Question 19

refer to picture on actual practice exam. What type of nondisjunction is seen in this human karyotype and what is the chromosomal sex of this person?

Answer 19

extra somatic chromosme, female

Question 20

Use this model of a eukaryotic transcript to answer the following question.
E = exon and I = intron
5’-UTR E1 I1 E2 I2 E3 I3 E4 UTR-3’
Which components of the previous molecule will also be found in mRNA in the cytosol?

Answer 20

5’-UTR E1 E2 E3 E4 UTR-3’

Question 21

The cAMP receptor protein (CRP) is said to be reponsible for positive regulation of the lac operon because____

Answer 21

CRP bound to the CRP-binding site stimulates the transcription of the lac operon

Question 22

The genetic code is essentially the same for all organisms. From this, one can logically assume which of the following statements to be true?

Answer 22

A gene from an organism can theoretically be expressed by any other organism

Question 23

If cell x enters meiosis, and nondisjunction of one chromosome occurs in one of its daughter cells during meiosis II, how will this affect the gametes at the completion of meiosis?

Answer 23

one-quarter of the gametes descended from cell x will be n + 1, one-quarter will be n - 1, and half will be n

Question 24

refer to the picture in the actual practice exam. In a series of mapping experiments, the recombination frequencies for four different linked genes of Drosophila were determined as shown in the figure. Based on this information, what is the order of these genes on a chromosome map?

Answer 24

b-rb-cn-vg

Question 25

According to central dogma, what is the intermediate molecule involved in the flow of information in a cell that should go in the blank? DNA ->____________ ->Proteins

Answer 25

mRNA

Question 26

A homozygous tomato plant with red fruit and yellow flowers was crossed with a homozygous 26) tomato plant with golden fruit and white flowers. The F1 all had red fruit and yellow flowers. The F1 were testcrossed by crossing them to homozygous recessive individuals, and the following offspring were obtained:

Red fruit and yellow flowers-41
Red fruit and white flowers-7
Golden fruit and yellow flowers-8
Golden fruit and white flowers-44

how many map units separate those genes?

Answer 26

15

Question 27

During the elongation phase of translation, which site in the ribosome represents the location where a codon is being read?

Answer 27

the A site

Question 28

What is the definition of one map unti?

Answer 28

a 1% frequency of recombination between two genes

Question 29

A single base subsitution mutation is likely to have a less deleterious effect when the base change exhibits which of the following results?

Answer 29

a codon that specifies the same amino acid as the original codon

Question 30

A particular triplet of bases in the template starnd of DNA is 5’-AGT-3’. What would be the corresponding codon for the mRNA that is transcribed?

Answer 30

3’-UCA-5’

Question 31

Which of the following statements correctlt describes the function of a signal peptide?

Answer 31

It helps target a protein to the ER

Question 32

Which of the following statements is true of linkage?

Answer 32

The closer two genes are on a chromosome, the lower the probability that a crossover will occur between them.

Question 33

Which of the following is **most likely ** to have a ubiquitin “tag” and get sent to the proteosomefor processing?

Answer 33

A protein that has completed its job, and is no longer needed

Question 34

Why is the one gene-one enzyme hypotheis not entirely accurate?

Answer 34

A) Some genes encode proteins that are not enzymes.
B) Some genes encode a piece of a protein, not the entire protein.
C) Some genes encode functional RNA molecules, not polypeptides.

Question 35

When Thomas Hunt Morgan crossed his red-eyed F1 generation flies to each other, the F2 35) generation included both red- and white-eyed flies. Remarkably, all the white-eyed flies were male. What was the explanation for this result?

Answer 35

the gene involved is on the x chromosome

Question 36

What would occur if the repressor of an inducible operon (like the lac operon) were mutated so it could not bind the operator?

Answer 36

continuous transcription of the operon’s genes

Question 37

Which of the following DNA mutation is most likely to damage the protein it specifies?

Answer 37

a base-pair deletion

Question 38

Which of the follwing processes occurs in prokaryotes but not in eukaryotes?

Answer 38

transcription and translation occur simultaneously

Question 39

Which of the following processes correctly describes alternative RNA splicing?

Answer 39

It can allow the production of proteins of different sizes and functions from a single mRNA

Question 40

In cats, black fur color is caused by an X-linked allele; the other allele at this locus causes orange 40) color. The heterozygote is tortoiseshell. What kinds of offspring would you expect from the cross of a black female and an orange male?

Answer 40

tortoiseshell females; black males