WRAP Session Qs

Question 1

Aim: we performed a study to assess whether neonatal hypertension is associated with maternal SSRI use during late pregnancy.
MEthods: between 1998-2003, 307 women with neonatal hypertension and 836 matched control infants/parents. Maternal interviews were conducted by nurses who were blinded, to establish med use/co-founders.
What type of study design is being used?
A) Case
B) Case-Control
C) Cohort
D) RCT

Answer 1

B) Case-Control

Question 2

The Wakefield Lancet paper claimed that the patients studied were consecutive admissions to the Royal Free Hospital. In fact, several were referred by sympathetic groups/doctors.
What is the name given to this design flaw?

A)Un-blinding
B)Allocation concealment
C)Measurement error
D)Selection bias
E)Intention-to-treat

Answer 2

D)Selection bias

Question 3

‘We did this open-label, cluster-randomised trial at 49 primary care practices in Scotland and the Tyneside region of England.’

An open label study does not blind researchers or participants to the treatment. Why was this method used? (1)

Answer 3

-you cant give a placebo for someone on an 850 kcal diet- very hard to conceal intervention

-

Question 4

Headmaster hears CBT can increase under-achieving students performance, so creates a trial where pupils sit a progress test. Those scoring >1STD below mean get CBT next term, another progress test then sat. What design would improve this study?
A) Case 
B) Case Control
C) Cohort Prospective
D) RCT

Answer 4

D) RCT

Question 5

BCR-ABL gene is made as a result of a chromosomal translocation and is responsible for 95% of cases, of chronic myelogenous leukaemia. Which of Koch’s postulates does this satisfy?
A) found in diseased- not healthy people
B) can be propagated in culture
C) induces disease when introduced to healthy people
D) reisolated from infected cell

Answer 5

A) found in diseased- not healthy people

Question 6

You are monitoring the levels of HIV, in the blood of AIDS patients. You perform qPCR, using HIV specific primers. Which of the following steps comes first when preparing samples:
A) Add qPCR primers
B) Add reverse transcriptase
C) Add dNTPs
D) Add fluorescent probe
E) Add anti-HIV antibody

Answer 6

B) Add reverse transcriptase

Question 7

Your results are inconclusive and the viral mechanism of entry remains unclear.
However, you still want to tray and make an effective therapy! You have a compound library and want to identify compounds that inhibit viral entry.

Which method might you use to do this?

GWAS
Phase 1 clinical trial
Drug-target modelling
Screen
CRISPR mutagenesis

Answer 7

Screen

Question 8

‘All oral antidiabetic and antihypertensive drugs were discontinued on day 1 of the weight management programme, with standard protocols for drug reintroduction under national clinical guidelines, if indicated by regular monitoring of blood glucose and blood pressure.’

Which guideline from the Declaration of Helsinki does the reintroduction protocol follow? (1)

Answer 8

1. Risk/Benefit analysis

2. Primary duty is to patient care

Question 9

Headmaster hears CBT can increase under-achieving students performance, so creates a trial where pupils sit a progress test. Those scoring >1STD below mean get CBT next term, another progress test then sat. Mean score for CBT students =closer to mean score.. why?
A) CBT improves performance
B) regression to the mean
C) CBT correlates with performance
D) 2nd progress test is easier
E) Placebo effect

Answer 9

B) Regression to the mean

Question 10

You want to understand the cellular function of a disease associated with a disease.
Which technique would be suitable?

PCR
Whole genome sequencing
qPCR
CRISPR
RNA seq
GWAS

Answer 10

CRISPR

Question 11

When deciding whether to fund a particular treatment or health technology, NICE uses QALY to generate a generic measure of its utility. Which of the following does the use of QALYS allow?
A) time trade-off analysis
B) comparison of different treatments
C) measurement of clinical efficacy
D) calculation of QOL score
E) calculation of treatment costs

Answer 11

D) calculation of QOL score

Question 12

You want to know if a specific gene has been upregulated (i.e. is being transcribed more) in cancer cells.
Which technique would be suitable?

PCR
Whole genome sequencing
qPCR
CRISPR
RNA seq
GWAS

Answer 12

qPCR

Question 13

Headmaster hears CBT can increase under-achieving students performance, so creates a trial where pupils sit a progress test. Those scoring >1STD below mean get CBT next term, another progress test then sat. He wants to improve this even further- who would you study (Not including control)?
A) all pupils
B) under-achieving students

Answer 13

B) under-achieving students

Question 14

A 50-year-old woman has routine mammography screening. She tests positive, is alarmed, and wants to know whether this means she has breast cancer. You have the following information:
The prevalence of breast cancer is 1%
If a woman has breast cancer, the probability that she tests positive is 90%
If a woman does not have breast cancer, the probability that she nevertheless tests positive is 9%

What are her chances of having breast cancer?
A.	9 in 10
B.	9 in 11
C.	1 in 9
D.	1 in 11
E.	1 in 100

Answer 14

D. 1 in 11

Question 15

You hypothesise that the virus suppresses the expression of several genes in target cells, leading to an decreased inflammatory response.

Which method would be most suitable to identify which genes are supressed?

Genome sequencing
GWAS
PCR
qPCR
RNAseq

Answer 15

RNAseq

Question 16

A newly discovered virus, LEOBA, is known to infect leukocytes. You want to design a strategy to diagnose infection using blood samples.

Which method would be most suitable?

Genome sequencing
GWAS
PCR
qPCR
RNAseq

Answer 16

PCR

Question 17

You want to know whether a virus is sexually transmitted. You interview two groups of people – one with the virus and one without - to determine their sexual habits.

How might you perform a cohort study to address the question? (3)

Answer 17

Take a group of volunteers from the target population

Ask them to record their sexual activity over a period of time

Determine whether there is a higher incidence of LEOBA in those who have unprotected sex.

Question 18

When conducting an RCT, what does the term randomisation mean?
A) Neither the experimenter nor participants know a participants assignment
B) participants are equally likely to be assigned to groups
C) participants are matched to differ on key variables
D) sample is representable of the population
E) experimenter does not know a person’s assignment

Answer 18

B) participants are equally likely to be assigned to groups

Question 19

You want to know which genes are involved in susceptibility to Alzheimer’s disease, a complex disease with several genetic and environmental contributing factors.
Which technique would be suitable?

PCR
Whole genome sequencing
qPCR
CRISPR
RNA seq
GWAS

Answer 19

GWAS

Question 20

You are investigating the effect of an inflammatory cytokine on collagen secretion by fibroblast cells grown in culture.
You analyse your gene set using an annotated gene database (e.g. DAVID).
What will the database look for?
A) Over-representation of genes involved in known pathways
B) Under-representation of genes involved in known pathways
C) Number of genes involved in known pathways
D) Number of genes involved in unknown pathways

Answer 20

A) Over-representation of genes involved in known pathways

Question 21

When designing your guide sequence you use an online tool to assess the candidate targets.

Which of the following properties of a guide sequence would preclude its use?

A) Hairpin formation
B) Similar off-target sequences
C) It is on the –ve strand of DNA
D) It is on the X chromosome
E) It is intronic

Answer 21

B) Similar off-target sequences

Question 22

You want to know if a specific chromosomal translocation has occurred.
Which technique would be suitable?

PCR
Whole genome sequencing
qPCR
CRISPR
RNA seq
GWAS

Answer 22

PCR

Question 23

Cluster randomisation randomises the practices not the participants.

List one disadvantage of this method? (1)

Answer 23

• Not going to control for ability to care for patients

- Pick a particular practice with diet/lifestyle = lead to skewing

Question 24

You are performing your research project to determine whether background noise affects concentration. You do not want the participants to know that this is what you are studying as you think it may confound your results.
How do you ensure informed consent is obtained?

A) It is not required – there is no harm
B) You can’t – the study is unethical
C) Debrief the participants
D) Ask for consent to ‘Any Purpose Research’ (APR)
E) Turn a blind-eye

Answer 24

Debrief the participants

Ask for consent to ‘Any Purpose Research’ (APR)

Question 25

BCR-ABL gene is made as a result of a chromosomal translocation and is responsible for 95% of cases, of chronic myelogenous leukaemia. Which technique could be used as a quick way to diagnose CML?
A) electron microscopy
B) immunostaining
C) genome sequencing
D) PCR
E) qPCR

Answer 25

C) genome sequencing

Question 26

You want to identify the mutated gene responsible for an inherited, monogenic disease.
Which technique would be suitable?

PCR
Whole genome sequencing
qPCR
CRISPR
RNA seq
GWAS

Answer 26

Whole genome sequencing

Question 27

You want to know whether a virus is sexually transmitted. You interview two groups of people – one with the virus and one without - to determine their sexual habits.

What kind of study design is this?

Case study
Case-control
Cohort
GWAS
Randomised control trial

Answer 27

Case-Control

Question 28

Type 2 diabetes is a complex disease resulting from an interaction between several genetic and environmental factors. Estimates of heritability range from 20-80%.
How might you identify genetic variants associated with the disease?
A) Proteomics
B) GWAS
C) Gene knockouts
D) Candidate gene sequencing
E) RNA sequencing

Answer 28

B) GWAS

Question 29

You wish to study the recruitment of inflammatory cells to wounds and wish to film the path of their migration from when they exit the circulation to when they reach the wound.
Which model organism would be the most suitable?
A) Yeast
B) Worm
C) Fruit fly
D) Zebrafish
E) Mouse

Answer 29

D) Zebrafish

Question 30

You are studying the regulation of cell division and want to know which genes are required for mitosis. You decide to use yeast as a model organism for your study.
Which technique would be the most suitable?

A)RNA sequencing of dividing cells
B) PCR candidate genes
C) Randomly mutate genes
D) Genome sequencing
E) Western blotting

Answer 30

C) Randomly mutate genes

Question 31

GWAS studies of T2D have identified several SNPs associated with the disease. Each SNP correlates with a significant but very small increase in the likelihood of having T2D.
Generally, why don’t GWAS studies find SNPs with large effects?

A) These can be deleterious for survival
B) Most SNPs are in non-coding regions
C) They are only single base pair changes
D) Large parts of the genome are still unsequenced
E) Cells repair DNA mutations efficiently

Answer 31

A) These can be deleterious for survival

Question 32

You are performing a study to determine whether drinking red wine reduces the risk of stroke in elderly patients who have had a heart attack. What is your Population-Intervention-Comparison-Outcome? 
P
I
C
O

Answer 32

P- elderly patients who have had a heart attack i.e. <65
I- drinking red wine e..g 200ml glass per night
C- same population, no wine
O- reduced stroke risk measure

Question 33

Cystic fibrosis sufferers often suffer from bacterial lung infections. In order to determine if they are susceptible to infection by a particular bacterial species, you decide to analyse sputum samples from a sample of patients. Which technique would provide the most information on which bacteria were present?
A) PCR
B) qPCR
C) Next generation sequencing
D) electron microscopy
E) Immunoflurocence

Answer 33

C) Next generation sequencing

Question 34

You are performing a phase 1 clinical trial for T2D. The drug is meant to increase insulin sensitivity, what is a key feature of such a trial?
A) participants must be randomised
B) patients must be healthy
C) patients must be diabetic
D) dose is increased sequentially
E) ITTA should be used

Answer 34

D) dose is increased sequentially

Question 35

You wish to study the contribution of inflammatory cells to scarring during wound healing. You have wild-type mice and also a colony of PU.1 knockout mice. As a consequence of the knockout, PU.1 -/- mice are unable to produce any inflammatory cells (e.g. macrophages and neutrophils) and interestingly, they do not scar.
How could you begin to investigate which proteins made by inflammatory cells maybe involved in scar formation?

A)Compare gene expression in wound tissue between the two mice
B) Compare gene expression in fibroblasts between the two mice
C) Sequence the DNA of both mice
D) Make knockouts of candidate genes
E) Immunofluorescent staining

Answer 35

A)Compare gene expression in wound tissue between the two mice

Question 36

You want to know which genes have been upregulated in cancer cells.
Which technique would be suitable?

PCR
Whole genome sequencing
qPCR
CRISPR
RNA seq
GWAS

Answer 36

RNA seq

Question 37

You want to know if a patient sample contains a known bacterium or virus.
Which technique would be suitable?

PCR
Whole genome sequencing
qPCR
CRISPR
RNA seq
GWAS

Answer 37

PCR

Question 38

Which term is used to describe co-segregation of a genetic marker with a disease phenotype?

Answer 38

Linkage

Question 39

In the intervention group, six (4%) participants consented, but thereafter never engaged with the intervention, and 26 (17%) participants withdrew from treatment during the first 12 months (n=15 during total diet replacement, n=6 during stepped food reintroduction, and n=5 during weight loss maintenance). An intention-to-treat analysis was performed

Control 
Intervention
Outliers
Missing
Ignored

Answer 39

Intervention

Question 40

You are recruiting participants for a randomised controlled trial to test the efficacy of a new drug in treating her-2 positive breast cancer.
Which of the following does the Declaration of Helsinki state you should do?
A) Gain informed consent
B) Not put the patient at risk
C) Allow the patient to withdraw
D) Publish your findings
E) Use competent staff

Answer 40

A) Gain informed consent
B) Not put the patient at risk
C) Allow the patient to withdraw
D) Publish your findings
E) Use competent staff

Question 41

According to Thomas Kuhn, a paradigm shift changes the way we view the world. What happens to start the process of this shift.
A) established scientists retire/die
B) evidence contradicts current paradigm
C) new theory proposed

Answer 41

B) evidence contradicts current paradigm

Question 42

Cluster randomisation randomises the practices not the participants.

List one advantage of this method? (1)

Answer 42

Primary care physician’s could focus their care onto one method, and basically do it better

Reduce cross-over as they don’t see the alternative method

Question 43

You are working on a project to develop new antibiotics. You undertake a screen of bacteria present in soil samples to identify secreted molecules with anti-microbial activity.
Name two advantages of using this screening approach over rational drug design.

Answer 43

You will be identifying active compounds at the outset and will not have to trust that a design strategy will work
Nature has already made large numbers of active molecules – so you don’t have to

Question 44

Observation studies can show a significant correlation between variables e..g. amount smoked, and risk of lung cancer. Which factor makes it hard for observational studies to establish cause and effect?
A) Confounding variables
B) measurement inaccuracy
C) observer bias
D) sample variation
E) selection bias

Answer 44

A) Confounding variables

Question 45

You are attempting to develop a molecule to inhibit the tyrosine kinase activity of the BCR-ABL protein. In order to identify lead compounds for further development, you decide to screen a library of 1000 compounds.
What assay would be the most suitable?
A) Proliferation assay of a human cell line expressing BCR-ABL
B) Myeloid cell proliferation in BCR-ABL transgenic mouse
C) In vitro kinase assay with purified BCR-ABL protein
D) Phase 1 clinical trial
E) Proliferation assay of a wild-type human cell line

Answer 45

C) In vitro kinase assay with purified BCR-ABL protein

Question 46

Mean HbA1c fell by −0·9% (SD 1·4) in the intervention group and increased by 0·1% (1·1) in the control group (95% CI −1·10 to −0·59; p<0·0001).

What does the 95% CI indicate? (3)

Answer 46

95% confident

that in the population of patients with T2D,

that the HbA1c level will be reduced by 0.1%

following intervention by between -0.59 and -1.1%

compared to the control

Question 47

For your project, you are performing a randomised controlled trial to answer the question ‘Does exercise improve learning?’

What is your research hypothesis?

A)Exercise improves learning
B)There is no effect of exercise on learning
C)The amount of exercise correlates with learning ability
D)There is no correlation between exercise and learning ability
E) Exercise may improve learning

Answer 47

A)Exercise improves learning

Question 48

Which of the following is the key difference between experimental and observational research?
A) experimental research does not use correlation
B) experimental research is not empirical
C) experimental research manipulates variables
D) observational research does not involve objective measurement
E) observational research is not replicable

Answer 48

C) experimental research manipulates variables

Question 49

For your project, you are performing a randomised controlled trial to answer the question ‘Does exercise improve learning?’
How could you measure learning?

A) Performance in an IQ test
B)) Performance in end of year ASK
C) Performance in an essay you set
D) Memory recall test (i.e. objects on a tray)
E) Performance in ASK test you set

Answer 49

E) Performance in ASK test you set

Question 50

You wish to create a mouse model to study the effect of a specific substitution mutation in a gene. The mutation is thought to be oncogenic and contribute to the formation of liver tumours.
What model would be the most suitable?

Knock-out mouse or
Knock-in mouse

Answer 50

Knock-in mouse

Question 51

Your DAVID search reveals a pathway involving a specific kinase enzyme. You wish to know if this kinase is required for the secretion of collagen.
How will you test this?

A) Measure gene expression +/- a kinase inhibitor
B) Measure collagen secretion +/- a kinase inhibitor
C) Search the database for known collagen regulators
D) Repeat the experiment in collagen knock-out cells

Answer 51

B) Measure collagen secretion +/- a kinase inhibitor

Question 52

Name four dimensions of the EQ-5D? (2)

Answer 52

• mobility
• self-care
• anxiety and depression
• pain/discomfort
• normal routines

Question 53

You wish to know which genes are up-regulated by testosterone. You design an experiment where cultured muscle cells are treated with testosterone or a control.
Which technique would be the most suitable to gather the required data?
A) Proteomics
B) GWAS
C) Genome sequencing
D) Candidate gene sequencing
E) RNA sequencing

Answer 53

E) RNA sequencing

Question 54

A newly discovered virus, LEOBA, is known to infect leukocytes. You want to design a strategy to determine the viral load (titre) of infected patients.

Which method would be most suitable?

Genome sequencing
GWAS
PCR
qPCR
RNAseq

Answer 54

qPCR

Question 55

For your project, you are performing a randomised controlled trial to answer the question ‘Does exercise improve learning?’
How will you know your study has been successful?
A) You will show an effect of exercise on ASK scores
B) You will obtain a p value <0.05
C) You will have evidence to support or reject your hypothesis
D) Your 95% C.I. will not span 0
E) You will get a grade of 2:1 or above

Answer 55

C) You will have evidence to support or reject your hypothesis

Question 56

You wish to know which genes are up-regulated by muscle cells in response to testosterone. You design an experiment where cultured human muscle cells are treated with testosterone or a control.
Before you start, what information do you need to know in order for this technique to be useful?

A) Which genes are likely to be upregulated
B) The sequences of all known human genes
C) The testosterone receptor binding sequence
D) How many genes will be upregulated
E) Any confounding pseudogenes

Answer 56

B) The sequences of all known human genes

Question 57

Alzheimer’s disease is characterised by several changes in the brain. One of these is the formation of amyloid plaques, which are thought to contribute to neuronal death. The 5xFAD mouse model has been engineered to make an abundance of amyloid plaques.
Which 2 studies could be usefully performed using this mouse?

A) Efficacy of plaque-clearing antibodies
B) Evaluation of environmental risk factors for plaque formation
C) Plaque-induced neuronal function
D) Epigenetic causes of plaque formation

Answer 57

A) Efficacy of plaque-clearing antibodies

C) Plaque-induced neuronal function

Question 58

A study is performed to establish whether there is a correlation between BMI and onset of T2D. 1000, non-diabetic participants are recruited (aged 30-40) and BMI recorded. They were monitored for 10 years and had diabetic status recorded.
What kind of study is being used?
A) Case 
B) Case-Control
C) Cohort Prospective
D) RCT

Answer 58

C) Cohort Prospective

Question 59

You hypothesise that the virus supresses the expression of several genes in target cells, leading to an decreased inflammatory response.

List the steps you would take to perform an RNA seq analysis of infected cells? (4)

Answer 59

1. Take leukocytes from infected and uninfected volunteers
2. Purify mRNA
3. Convert to cDNA (using reverse transcriptase)
4. Sequence (quantify) using next generation sequencing
5. Determine statistical significance of differences for each gene

Question 60

You hypothesise that the virus binds a specific protein on the surface of target leukocytes to infect cells.
How would you determine whether this protein was required for viral infection of cultured leukocytes? (3)

Answer 60

1. Take some leukocytes
2. Knock-out / disrupt the gene coding for the protein (using CRISPR or RNAi)
3. Expose cells to virus in culture
4. Compare levels of viral DNA in knock-down cells compared to WT (using PCR/qPCR)

Question 61

You are performing an intention to treat analysis on whether drinking milk can increase bone strength in elderly. You design an RCT with two groups, those in the intervention group are given milk to drink, whereas those in the control are asked not to drink milk. A participant in control thinks drinking milk must be a good idea and decides to drink it daily. How should their bone strength data be analysed?
A) as intervention data point
B) as a control data point
C) emitted
D) groups should be re-randomised

Answer 61

B) as a control data point

Question 62

You would like to design an assay for Herpes detection. Herpes virus is a double-stranded DNA virus, here is a sequence from its genome. Design a forward and reverse primer:
5’-GATCGGTTAA
3’-TTGAGAGGAG

Answer 62

5’- CTAGCCAATT

3’- AACTCTCCTC

Question 63

You are working on a project to develop new antibiotics. You undertake a screen of bacteria present in soil samples to identify secreted molecules with anti-microbial activity.
What would your assay be?

Answer 63

Test secreted molecules for their ability to kill microbes (or inhibit growth)

Question 64

You wish to study the recruitment of inflammatory cells to wounds and wish to film the path of their migration from when they exit the circulation to when they reach the wound.
Which model organism would be the most suitable?
A) Yeast
B) Worm
C) Fruit fly
D) Zebrafish
E) Mouse

Answer 64

D) Zebrafish

Question 65

7. You wish to target a double stranded DNA sequence using CRISPR technology. You are using Cas9 from S.pyogenes which recognises the PAM sequence of NGG (where N is any base). The top strand of the sequence is:
   5’ GATTCCTATTACCATGAATTATGGGTATTCGGTGCAGATTACGA 3’
   How many potential target sequences are there?

1
2
3
4
5

Answer 65

5

Question 66

During an RCT, allocation concealment should be used to assign participants to control/intervention groups. Why?
A) to blind patient
B) to blind physician
C) to ensure equal numbers in groups
D) reduce dropout
E) prevent selection bias

Answer 66

E) prevent selection bias

Question 67

Randomisation is performed from sub-groups – i.e. Tyneside and Scottish practices were randomised separately.

Why was this method used? (1)

Answer 67

• Helps ensure even split of ethnographic participants

- And in case practice size has an effect- randomise confounding variables

Question 68

You are performing a phase 1 clinical trial for T2D. The drug is meant to increase insulin sensitivity, what should you measure?
A) insulin sensitivity
B) disease progression
C) drug safety
D) efficacy in mice
E) drug administration costs

Answer 68

C) drug safety