Unit 4 Practice Flashcards by george millard

When Thomas Hunt Morgan crossed his red-eyed F1 generation flies to each other, the F2 generation included both red-and white-eyed flies. Remarkably, all the white-eyed flies were male. What was the explanation for this result?

A)The gene involved is located on the X chromosome.
B)Other male-specific factors influence eye color in flies.
C)The gene involved is located on the Y chromosome.
D)The gene involved is located on an autosome, but only in males.

The gene involved is located on the X chromosome.

How well did you know this?

Not at all

Perfectly

In cats, black fur color is determined by an X-linked allele; the other allele at this locus determines orange color. The heterozygote is tortoiseshell. What kinds of offspring would you expect from the cross of a black female and an orange male?

A) tortoiseshell females; tortoiseshell males
B) black females; orange males
C) orange females; black males
D) tortoiseshell females; black males

Tortoiseshell females; black males

How well did you know this?

Not at all

Perfectly

Red-green color blindness is a sex-linked recessive (Xn) trait in humans. Two people with normal color vision have a color-blind son. What are the genotypes of the parents?’

A)XnXn and XnY
B)XNXN and XnY
C)XNXn and XNY
D)XNXN and XNY

XNXn and XNY

How well did you know this?

Not at all

Perfectly

Cinnabar eye color is a sex-linked, recessive characteristic in fruit flies. If a female having cinnabar eyes is crossed with a wild-type male, what percentage of the F1 males will have cinnabar eyes?

A)25%
B)0%
C)50%
D)100%

100%

How well did you know this?

Not at all

Perfectly

Which of the following individuals will inherit an X-linked allele from a man who carries it?

A)half of his daughters
B)all of his children
C)all of his daughters
D)all of his sons

all of his daughters

How well did you know this?

Not at all

Perfectly

Which of the following statements regarding gene linkage is correct?

A)Linked genes are found on different chromosomes.

B)The closer two genes are on a chromosome, the lower the probability that a crossover will occur between them.

C)All of the traits that Mendel studied seed color, pod shape, flower color, and others are due to genes linked on the same chromosome.

D)The observed frequency of recombination of two genes that are far apart from each other has a maximum value of 100%.

The closer two genes are on a chromosome, the lower the probability that a crossover will occur between them.

How well did you know this?

Not at all

Perfectly

Which of the following statements would explain a testcross involving F1dihybrid flies in whichmore parental-type offspring than recombinant-type offspring are produced?

A)Recombination did not occur in the cell during meiosis.

B)The two genes are linked but on different chromosomes.

C)Both of the characters are controlled by more than one gene.

D)The two genes are closely linked on the same chromosome.

How well did you know this?

Not at all

Perfectly

What does a recombination frequency of 50% indicate?

A)The two genes are likely to be located on different chromosomes.

B)Abnormal meiosis has occurred.

C)The genes are located on sex chromosomes.

D)All of the offspring have combinations of traits that match one of the two parents.

A)The two genes are likely to be located on different chromosomes.

How well did you know this?

Not at all

Perfectly

Use the following map of four genes on a chromosome to answer the question.

A-W 5
A-G 20
A-E 8
E-G 12

Between which two genes would you expect the highest frequency of recombination?

A)AandE
B)AandG
C)AandW
D)EandG

B)AandG

How well did you know this?

Not at all

Perfectly

During meiosis, a defect occurs in a cell that results in the failure of spindle microtubules binding at the kinetochores. Which of the following statements describes the most likely result of such a defect?

A)The defect will be bypassed in order to ensure normal chromosome distribution in the new cells.
B)Excessive cell divisions will occur resulting in cancerous tumors and an increase in the chromosome numbers known as polyploidy. C)New microtubules with more effective binding capabilities to kinetochores will be synthesized to compensate for the defect.
D)The resulting cells will not receive the correct number of chromosomes in the gametes, a condition known as aneuploidy.

D)The resulting cells will not receive the correct number of chromosomes in the gametes, a condition known as aneuploidy.

How well did you know this?

Not at all

Perfectly

A particular triplet of bases in the template strand of DNA is 5’-AGT-3’. What would be the corresponding codon for the mRNA that is transcribed?

A)3’-ACU-5’
B)3’-UGA-5’
C)5’-TCA-3’
D)3’-UCA-5’

D)3’-UCA-5’

How well did you know this?

Not at all

Perfectly

The genetic code is redundant. What is meant by this statement?

A)The genetic code is different for different domains of organisms.

B)The genetic code is universal (the same for all organisms).

C)More than one codon can specify the addition of the same amino acid.

D)A single codon can specify the addition of more than one amino acid.

C)More than one codon can specify the addition of the same amino acid.

How well did you know this?

Not at all

Perfectly

Codons are three-base sequences in mRNA that specify the addition of a single amino acid to the growing protein chain during translation. How do eukaryotic codons and prokaryotic codons compare?

A)The translation of codons is mediated by tRNAs in eukaryotes, but translation requires no intermediate molecules such as tRNAs in prokaryotes.

B)Prokaryotic codons usually contain different bases than those of eukaryotes.

C)Prokaryotic codons usually specify different amino acids than those of eukaryotes.

D)Codons are a nearly universal language among all organisms

How well did you know this?

Not at all

Perfectly

Transcription in eukaryotes requires which of the following molecules in addition to RNA polymerase?

A)ribosomes and tRNA
B)aminoacyl-tRNA synthetase
C)anticodons
D)several transcription factors

D)several transcription factors

How well did you know this?

Not at all

Perfectly

In the structural organization of many eukaryotic genes, individual exons may be related to which of the following?

A)the number of start sites for transcription

B)the various domains of the polypeptide product

C)the number of polypeptides making up the functional protein

D)the sequence of the intron that immediately precedes each exon

B)the various domains of the polypeptide product

How well did you know this?

Not at all

Perfectly

A particular triplet of bases in the coding sequence of DNA is AAA. The anticodon on the tRNA that binds the mRNA codon is ________.

A)UUU
B)AAA
C)TTT
D)UUA

A)UUU

During the elongation phase of translation, which site in the ribosome represents the locationwhere a codon is being read?

A)P site
B)A site
C)E site
D)the large ribosomal subunit

B)A site

Which of the following processes is the first event to take place in translation in eukaryotes?

A)the small subunit of the ribosome recognizes and attaches to the 5’ cap of mRNA
B)the ribosome reaches a stop codon
C)binding of the larger ribosomal subunit to smaller ribosomal subunits
D)base pairing of activated methionine-tRNA to AUG of the messenger RNA

A)the small subunit of the ribosome recognizes and attaches to the 5’ cap of mRNA

How might a single base substitution in the sequence of a gene affect the amino acid sequence of a protein encoded by the gene?

A)Only a single amino acid could change, because the reading frame would be unaffected.

B)The amino acid sequence would be substantially altered, because the reading frame would change with a single base substitution.

C)It is not possible for a single base substitution to affect protein structure, because each codon is three bases long.

D)All amino acids following the substitution would be affected, because the reading frame would be shifted.

A)Only a single amino acid could change, because the reading frame would be unaffected.

How does the primary transcript in the nucleus of a eukaryotic cell compare to the functional mRNA?

A)the primary transcript is smaller than the mRNA
B)the primary transcript is the same size as the mRNA
C)the primary transcript is larger than the mRNA
D)both the primary transcript and mRNA contain introns

C)the primary transcript is larger than the mRNA

Which of the following statements is the most current description of a gene?

A)a discrete unit of hereditary information that consists of a sequence of amino acids

B)a unit of heredity that causes formation of a phenotypic characteristic

C)a DNA sequence that is expressed to form a functional product: either RNA or polypeptide

D)a DNA subunit that codes for a single complete protein

C)a DNA sequence that is expressed to form a functional product: either RNA or polypeptide

When taken up by a cell, which of the following molecules binds to a repressor so that the repressor no longer binds to the operator?

A)corepressor
B)promoter
C)repressor
D)inducer

D)inducer

Which of the following processes would result from a mutation that deactivates a regulatory gene of a repressible operon in an E. coli cell?

A)irreversible binding of the repressor to the operator

B)complete inhibition of transcription of the structural gene controlled by that regulator

C)continuous translation of the mRNA because of alteration of its structure

D)continuous transcription of the structural gene controlled by that regulator

Altering patterns of gene expression in prokaryotes would most likely serve an organism’s survival by ________

A)allowing each gene to be expressed an equal number of times

B)allowing an organism to adjust to changes in environmental conditions

C)allowing environmental changes to alter a prokaryote’s genome

D)organizing gene expression, so that genes are expressed in a given order

B)allowing an organism to adjust to changes in environmental conditions

A researcher found a method she could use to manipulate and quantify phosphorylation and methylation in embryonic cells in culture. In one set of experiments, she succeeded in increasing the acetylation of histone tails in the chromatin of the cells. Which of the following results would she most likely see in these cells? A)increased chromatin condensation B)decreased chromatin condensation C)inactivation of the selected genes D)decreased binding of transcription factors

B)decreased chromatin condensation

DNA methylation and histone acetylation are examples of which of the following processes? A)genetic mutation B)epigenetic phenomena C)chromosomal rearrangements D)translocation

B)epigenetic phenomena

Imagine that you've isolated a yeast mutant that contains histones resistant to acetylation. What phenotype would you predict for this mutant? A)The mutant will show decreased levels of gene expression. B)The mutant will require galactose for growth. C)The mutant will grow rapidly. D)The mutant will show increased levels of gene expression.

D)The mutant will show increased levels of gene expression.

A pre-mRNA 5000 nucleotides long makes a protein consisting of approximately 500 amino acids. This result is best explained by which of the following? A) Several stretches of termination sequences occur within pre-mRNA. B) The RNA polymerase enzyme breaks off and re-attaches to the DNA strand at intervals. C) Introns are present in the pre-mRNA and are spliced out during pre-mRNA processing. D) Ribosomes repeatedly pause and reinitiate translation after skipping several nucleotides. E) There is redundancy in the genetic code.

C) Introns are present in the pre-mRNA and are spliced out during pre-mRNA processing.

Ultraviolet exposure can commonly result in which of the following forms of DNA damage? A) Thymine dimer formation B) DNA base deletion C) DNA base insertion D) Mismatch pairing

A) Thymine dimer formation

What property of RNA enables some RNA molecules to function as enzymes? A) The ability to hydrogen bond with other nucleic acid molecules B) All of the above C) The presence of functional groups in some of the bases in RNA. D) RNA can be single-stranded yet can also fold into complex structures.

B) All of the above

The shortening of DNA with every cell cycle is compensated for in the germ cells by ______ A) addition of new nucleotides by polymerase. B) All of these mechanisms C) the enzyme telomerase which catalyzes the lengthening of telomeres at the end of DNA. D) several telomeric repeats at the end of each chromosome.

C) the enzyme telomerase which catalyzes the lengthening of telomeres at the end of DNA.

The figure below shows different types of point mutations for the DNA sequence TTC. Identify the type of mutation in each case. DNA -> RNA TTC -> AAG TTT -> AAA ATC -> UAG TTC -> AGG A) i- no mutation; ii- frameshift mutation; iii-nonsense mutation; iv- missense mutation B) i- no mutation; ii- silent mutation; iii- missense mutation; iv- nonsense mutation C) i- no mutation; ii- silent mutation; iii- nonsense mutation; iv- missense mutation D) i- silent mutation; ii- silent mutation; iii- missense mutation; iv- nonsense mutation E) i- no mutation; ii- no mutation; iii- missense mutation; iv- nonsense mutation

C) i- no mutation; ii- silent mutation; iii- nonsense mutation; iv- missense mutation

The fact that the genetic code is universal indicates that all living organisms are A) genetically identical. B) have the same genomic sequence. C) None of these D) have the same anticodon sequence. E) evolutionarily related.

E) evolutionarily related.

A protein has a molecular weight of 3000 Da. If molecular weight of each amino acid in the protein is 100 Da, how long is the protein and how long would be the corresponding DNA sequence for this protein? A) 30 amino acids long; 90 bp B) 300 amino acids long; 100 bp C) 30 amino acids long; 30 bp D) 300 amino acids long; 30 bp E) 30 amino acids long; 100 bp

A) 30 amino acids long; 90 bp

How does RNA polymerase differ from DNA polymerase? A) RNA polymerase uses RNA as a template, while DNA polymerase uses DNA as a template. B) RNA polymerase can initiate RNA synthesis de novo (from scratch), while DNA polymerase requires a primer to initiate DNA synthesis. C) ll of them D) RNA polymerase can synthesize a polynucleotide in a 3’ to 5 direction, while DNA polymerase functions to assemble a polynucleotide in 5’ to 3’ direction.

B) RNA polymerase can initiate RNA synthesis de novo (from scratch), while DNA polymerase requires a primer to initiate DNA synthesis.

An enzyme that attaches a phosphate group to an other protein is called a __________.

Kinase

Given below is a processed, mature mRNA sequence corresponding to a short protein: CCAGGAUGACGCUAGCCGCAGCGAGCUAGGAGGAUGAGGGACCUAAAAAAAAA How many amino acids will the protein translated from this mRNA sequence have?