Unit 3 Exam Flashcards
Prokaryotic cells lack a nucleus. Therefore, the gene in prokaryotic cells are:
transcribed and translated almost simultaneously; transcriptionally controlled because translation begins before transcription ends
What will result from the binding of a transcription factor to an enhancer region?
increased transcription of a distant gene
Cancer causing genes are called
oncogenes
The sugar used in RNA is
Ribose
The correct pairing of bases in DNA is
A-T; C-G
The RNA components of ribosomes are synthesized in the
nucleolus
Protein synthesis is carried out by
Ribosomes
________ is the initiating amino acid of most newly synthesized proteins.
Methionine
__________ is the process by which the information in DNA is transferred to RNA.
Transcription
The ends of the linear chromosomes are maintained by
telomerase
Which of the following components is not involved during the formation of the replication fork?
ligase
If the sequence of the 5’ -3’ strand is AATGCTAC, then the complementary sequence has the following sequence:
3’-TTACGATG-5’
Meselson and Stahl’s experiments proved that DNA replicates by which mode?
semi-conservative
In eukaryotes, what is the DNA wrapped around?
histones
The experiments by Hershey and Chase helped confirm that DNA was the hereditary material on the basis of the finding that:
radioactive phosphorus was found in the cell
If DNA of a particular species was analyzed and it was found that it contains 27 percent A, what would be the percentage of C?
23 percent
How many nucleotides are in 12 mRNA codons?
36
What type of base is adenine?
Purine
The DNA chromosome of bacteria consists of ________.
A circular double stranded DNA
DNA is synthesized in a _________ direction.
5’ to 3’
Cardiac-muscle cells that must communicate with adjacent cells using electric impulses most likely have what kind of junctions between them?
Gap junctions
Assume that you transfer bacteria that were grown heavy 15N nitrogen to regular medium. What percentage of the DNA is composed of one heavy and one light chain after three generations?
25%
Hershey and Chase hypothesis was that DNA replication could be_ ?
Semiconservative, Conservative or Dispersive
Okazaki fragments are produced during DNA replication because __________.
DNA polymerase can add nucleotides only to the 3’ end of the growing strand
During DNA replication, the _______ is synthesized continuously, while the ______ is synthesized in pieces and liked by a ligase later on.
Leading strand; lagging
IN eukaryotes mRNA _______, and transcription takes place in the ________.
Is capped, polyadenylated, and spliced; nucleus
Gene expression in prokaryotes and eukaryotes ________.
Are somewhat different: in prokaryotes transcription and translation take place simultaneously, while they are separated in eukaryotes
In eukaryotes, _______ removes _______ and links _______. Such RNA processing is nonexistent in prokaryotes.
Spliceosome; introns; exons
MicroRNA has been discovered recently; it is a _____ regulator of _______.
Common; RNA turnover
Alternative splicing ______.
Links different exons of one pre-mRNA to produce several mature mRNA.
How many amino acids are in the eukaryotic protein, which has a 3213 nucleotide long open reading frame, including the start and the stop codons?
1070
mRNA is translated in a _____ direction, and proteins are synthesized in a ________ direction.
5’ to 3’; amino to carboxy terminus
Protein synthesis is terminated when _______.
The protein release factor binds to a stop codon at the A site of the ribosome
The anticodon for tryptophan (Trp) is 5’-CCA-3’. Which mRNA codon would the Trp-tRNA pair with?
5’-UGG-3’
Use the standard genetic code table to determine which mRNA codes for the following protein: Met-Arg-Gly-Tyr-Ala-Arg
AUGCGAGGCUAUGCUCGGUGA
In E. coli, the gene lacl codes the lac operon repressor. Which of the following statements is true about an E. coli strain, which is lacl-, that is null mutant for lacl?
There would be no lac operon repression, thus lacA, lacZ and lacY genes would be constitutively expressed regardless of the presence of lactose.
Repressible operons are typical in ______, e.g., the _____. And inducible operons are typical in ______, e.g., the ______.
Anabolic pathways; trp operon; catabolic pathways; lac operon
When lactose is _______, the lac operon is _______, since a _______ binding to the operator within the operon.
Absent; inactive; repressor is
When tryptophan is present in sufficient quantities, the trp operon is ______, since the _______ binds to the operator within the operon.
Turned off; tryptophan-activated repressor
______ is determined by the _____ of activators that are available in a particular tissue to bind to genomic enhancer regions.
Tissue specific gene expression; combination
______ activated the lac operon, when the _______ level is low.
The catabolite activator protein (CAP); glucose
What is the one characteristic that all cancer have?
Loss of growth control
