Self-Study Flashcards
deoxyribonucleic acid (DNA)
is the carrier of genetic information in both prokaryotes and eukaryotes
genome
Total genetic information of an organism
chromosomes
Genetic information (DNA) divided into independent domains
genes
Segments of DNA that are transcribed to direct the transcription of RNA
composition of nucleic acids
bases, sugars, and phosphate groups
purines
Double rings: adenine (A) and guanine (G)
Pyrimidines
Single rings: cytosine (C), thymine (T), uracil (U)
pyrimidine found in DNA only
Thymine
pyrimidine found in RNA only
Uracil
Purines/pyrimidine bases and pentose
nucleoSides
The pentose in RNA
Ribose
The pentose in DNA
deoxyribose
Phosphorylated nucleosides (such as mono, di or tri phosphates)
NucleoTides
how many bonds for AT base pairing?
2 hydrogen bonds
how many bonds for GC base pairing?
3 hydrogen bonds
enzyme
a catalyst, increases the rate of a chemical reaction but is not itself changed in the reaction
The molecule(s) acted upon by the enzyme
substrate(s)
contains the substrate binding site and the catalytic site of the enzyme
active site
Nucleases
hydrolyzes phosphodiester bonds
hydrolysis
breakdown of compound by chemical reaction with H2O
exonucleases
cleave the last nucleotide residue at either of the two terminals
endonucleases
cleave phosphodiester bonds in the interior of the polynucleotide
Nucleases that act only with specific base sequences
restriction endonucleases
DNA conformation primarily found in cells
B-DNA
conformation DNA-RNA hybrid during transcription
A-DNA
conformation found within DNA sequences that control gene transcription.
Z-DNA
Denaturation …
occurs at high temperatures, extreme pH ranges or extreme ionic strengths; under these conditions the double strands of DNA completely separate
Topoisomerases
Specific enzymes that regulate superhelices. They catalyze the breaking and rejoining of DNA strands
phosphodiesterases
any enzyme that breaks a phosphodiester bond
Type I topoisomerases
breaks only one DNA strand, allowing it to rotate about the other to relieve the supercoil, and ligates the break after supercoil is relieved
Type II topoisomerases
breaks both DNA strands, relaxes the supercoil, and then reseals the DNA
gyrases
topoisomerases that relieve supercoiling generated by the unwinding of DNA
cruciforms
Regions of DNA in which interchain hydrogen bonds are disrupted and intrachain bonds form - function in control of replication and transcription.
generally forms in DNA regions with a string of purine bases
Triple-stranded DNA with Hoogsteen base pairing (triplex)
In eukaryotic cells, almost all DNA is associated with a complex of basic proteins called …
Histones
Prokaryotic DNA does not contain histones; the DNA is associated with
HU proteins.
composition of histones
2 each of H2A, H2B, H3, and H4, forms histone disk around which DNA if supercoiled
H1 histone
An additional histone protein that does not form part of the disk but serves to stabilize the DNA which wraps around the histone octamer
Nucleosome
DNA with the histone disk (octamer) but no H1
Chromatosomes
DNA with the histone disk and the H1 histone
Nucleofilament
contains nucleosomes and chromatosomes
Chromatin
DNA with its associated proteins (nucleoproteins including nonhistone and histone proteins)
site of attachment of the chromosome to the mitotic spindle
centromere
The ends of chromosomes are called
telomeres
In prokaryotic cells, DNA is organized in a single chromosome that is a
double-stranded circular supercoil
Bacterial chromosomes are compacted into ….. by interaction with HU proteins, cations, polyamines, RNA and other nonhistone proteins
nucleoids
What is this sequence? 5’GGAATCGATCTTAAGATCGATTCC3’ 3’CCTTAGCTAGAATTCTAGCTAAGG5’
inverted repeat or palindrome
What is this sequence? 5’GGAATCGATCTTTTCTAGCTAAGG3’ 3’CCTTAGCTAGAAAAGATCGATTCC5’
Mirror repeat
What is this sequence? 5’GGAATCGATCTTGGAATCGATCTT3’ 3’CCTTAGCTAGAACCTTAGCTAGAA5’
direct repeat
noncoding sections of RNA
introns
coding sections of nucleotides (DNA or RNA)
exons
the removal of introns during transcription
splicing
short segments of RNA used to start DNA replication
primer
What is a DNA polymerase?
enzyme that carries out replication of DNA. It cannot start DNA synthesis, needs a primer
primers are synthesize by….
primase
In prokaryotes, removal of a mispairing during replication is done by …
Pol I, II, and III (acting as 3’–>5’ exonucleases)
enzyme that removes primers in prokaryotes
Pol I - acting as a 5’–>3’ exonuclease
What is released when a phosphodiester bond is formed?
pyrophosphate
What is semi-conservative replication?
the two parental strands separate, each strand is a template for synthesis of a complementary daughter strand
DNA helicases
unwinds the strands of DNA, allowing strands to separate
series of short pieces of DNA on the lagging strand
okazaki fragments
What are the functions of DNA polymerase I?
* primarily synthesizes that the lagging strand * can proofread the newly synthesized DNA and remove errors (3’—>5’ exonuclease activity) * only Pol I can remove primers (5’–>3’ exonuclease activity) * intermediate processivity
What are the functions of DNA polymerase II?
* involved primarily in DNA repair * can proofread DNA and remove errors (3’—>5’ exonuclease activity) * low processivity
What are the functions of DNA polymerase III?
* primarily synthesizes the leading strand * can proofread DNA and remove errors (3’—>5’ exonuclease activity) * high processivity
processivity
ability of an enzyme to remain on its substrate during synthesis
sliding clamp
prevents pol III from dissociating from the template until replication is complete
Origin of Replication (Ori)
sequence on the DNA strand where DNA polymerase and the primase initially bind
How many point (s) of origin of replication for prokaryotic cells?
One
How many point (s) of origin of replication for eukaryotic cells?
multiple points
In eukarytic cells, what are DNA segments between origins of replication called?
replicons
What phase of the cell cycle does replication in eukaryotic cells occur?
S (Synthesis) phase
What is the cell cycle controlled by in eukaryotic cell replication?
Cyclin-dependent kinases (CDKs)
What are the characterictics of DNA pol delta (eukaryotic)?
* high processitivity * catalyzes replication of the leading strand * proofreading function (3’—>5’ exonuclease activity)
The high processitivity of pol delta is due to what?
proliferating cell nuclear antigen (PCNA) - serves as a clamp
What are the characteristics of DNA pol alpha (eukaryotic)?
* low processivity * synthesizes the lagging strand * functions as a primase * disassembles the nucleosome prior to DNA replication
enzyme used in the replication of eukaryotic telomeres
telomerase (a reverse transcriptase)
reverse transcriptases
enzymes that use RNA as a template for DNA synthesis
rearranging DNA sequences by breaking and rejoining existing DNA molecules
DNA recombination
What is homologous genetic recombination?
DNA versions (alleles) of the same gene can be switched from one chromatid to another allowing for recombination of genes
At what stage does homologous genetic recombination occur?
prophase of meiosis
What is conservative site-specific recombination?
insertion of bacteriophage DNA into bacterial genome
Transposition
jumping genes or movement of DNA from one site to another within a chromosome
What type of RNA is a direct carrier of genetic information from DNA to protein?
messenger RNA (mRNA)
What is the half-life for mRNA?
minutes to several hours (shortest half life of all RNAs)
what is a poly A tail?
* many mRNA’s contain a poly A tail (20-200 adenine nucleotides) * length of tail determines stability of the mRNA
describe the general structure of a eukaryotic mRNA
* 5’-methylated cap (inverted methylated base) * leader sequence (5’-nontranslated sequence) * start codon * stop codon * 3’-nontranslated sequence * poly A tail
what is the purpose of the 5’cap on eukaryotic mRNA?
guards against attack
what % of RNA is made up of tRNA?
15%
What is the acceptor stem of tRNA?
amino acids attach to this active site - which is 3’OH terminal CCA
What are the two functions of tRNA?
* functions to activate amino acids for protein synthesis * recognizes codons in mRNA to ensure that the correct AA is incorporated into the peptide chain *
What is ribosomal RNA (rRNA)?
components of ribosomes where protein synthesis takes place
What % of cellular RNA is rRNA?
80%
ribosomes are complexes composed of RNA and protein molecules that form …
particles
What are Svedberg units (S)?
particles are named according to their sedimentation coefficient during centrifuge calculated in S units.
What is the size of the small particle in prokaryotic ribosomes?
30S subunit (16S rRNA and 21 proteins)
What is the size of the large particle in prokaryotic ribosomes?
50S (23S and 5S rRNAs and 34 proteins)
In prokaryotic ribosomes, the large and small subunits form …
the 70S particle
What is the size of the small particle in eukaryotic ribosomes?
40 S (18S rRNA and 30 proteins)
What is the size of the large particle in eukaryotic ribosomes?
60S (28S, 5.8S, 5S rRNAs and 50 proteins)
In eukaryotic ribosomes, the large and small subunits form …
80S particle
small nuclear RNA (snRNA)
recognizes introns on mRNA participating in splicing
Where are rRNAs synthesized?
nucleolus
small cytoplasmic RNA (scRNA)
RNA involved in the selection of proteins for export where it serves as a signal recognition particle
What are mitochondrial RNAs (mtRNAs)
* includes tRNA, rRNA, and mRNA that are transcribed from mitochondrial DNA * accounts for ~4% of cellular RNA
ribonucleoprotein particles (RNP)
these small RNA/protein molecules function in RNA processing, splicing, transport, control of translation and protein recognition that target proteins for export
RNAs that are enzymes are called…
ribozymes
Where does transcription take place?
nucleus or mitochondria
the point at which DNA is initially opended during transcription
transcription bubble
What is the promoter?
nucleotide sequence recognized by RNA polymerase for the initiation of transcription
What is the Pribnow box?
essential part of the promoter site for DNA transcription, with the sequence TATAAT
transcription can be increased by the presence of sequences called
enhancers (serve as binding sites for protein)
transcription can be decreased by the presence of sequences called
repressors
Errors in RNA biosynthesis are much more common than in DNA b/c
RNA polymerases have no editing or proofreading activity
What are the subunits for prokaryotic RNA polymerase?
two alphas, beta, beta prime, omega and sigma - forming the holoenzyme
what is the core enzyme (prokaryotic RNA pol)?
the holoenzyme without sigma subunit
What does the sigma subunit of prokaryotic RNA polymerase do?
it recognizes the promoter
name the product of Eukaryotic RNA polymerase I
rRNA
name the product of Eukaryotic RNA polymerase II
mRNA
name the product(s) of Eukaryotic RNA polymerase III
tRNA, 5S rRNA
name the product (s) of Eukaryotic mitochondrial RNA polymerase
all types (rRNA, tRNA, mRNA)
name the product (s) of Eukaryotic RNA polymerase in E.coli
all types (rRNA, tRNA, mRNA)
a mushroom poison
amanitin
What inhibitor is eukaryotic RNA pol II sensitive to?
alpha-amanitin (very sensitive)
What inhibitor is eukaryotic RNA pol III sensitive to?
alpha-amanitin
What inhibitor is eukaryotic mitochondrial RNA pol sensitive to?
rifampicin
What inhibitor is eukaryotic RNA pol in E.coli sensitive to?
rifampicin
Which eukaryotic RNA pol is responsible for 50% of cellular RNA biosynthesis?
RNA pol I
Which eukaryotic RNA pol is responsible for 20-40% of cellular RNA biosynthesis?
RNA pol II
Which eukaryotic RNA pol is responsible for 10% of cellular RNA biosynthesis?
RNA pol III
what are the 3 stop codons?
UAA, UAG, UGA
What is the start codon?
AUG (methionine)
Which two amino acids only have one code each?
Methionine (AUG); Tryptophan (UGG)
wobble effect
the ability for an anticodon to pair with more than one codon
What is inosine (I)?
a nucleotide, makes the anticodon less specific
Activation of aminoacyl-tRNA synthetases catalyze two reactions?
* activation of the AA with ATP forms the aminoacyl group * transfers the aminoacyl group to tRNA
what are the 2 methionyl-tRNAs in prokaryotes?
- initiator tRNA (initiates protein synthesis): fmet-tRNA - Met-tRNA - carries Met for other positions in the protein
What is the Shine-Dalgarno sequence?
the 5’ nontranslated leader sequence of mRNA that allows the mRNA to be correctly aligned on the rRNA small subunit
What is the function of antibiotics?
to interfere with the ability of cell to synthesize proteins
- Prevents binding of fmet-tRNA to the small subunit of prokaryotic ribosomes - Interferes with initiation of protein synthesis and causes misreading of codons
streptomycin
What is streptomycin?
- Prevents binding of fmet-tRNA to the small subunit of prokaryotic ribosomes - Interferes with initiation of protein synthesis and causes misreading of codons
Inhibits binding of aminoacyl-tRNAs to the mRNA-ribosome complex
tetracyclines
tetracyclines
Inhibits binding of aminoacyl-tRNAs to the mRNA-ribosome complex
- An analog of aminoacyl-tRNA; binds to A-site and stops chain elongation - Works well in both prokaryotes and eukaryotes
puromycin
puromycin
- An analog of aminoacyl-tRNA; binds to A-site and stops chain elongation - Works well in both prokaryotes and eukaryotes
Inhibits peptidyl transferase in prokaryotes
erythromycin
erythromycin
Inhibits peptidyl transferase in prokaryotes
inhibits peptidyl transferase in eukaryotes
cycloheximide
cycloheximide
inhibits peptidyl transferase in eukaryotes
a toxin from castor beans, inactivates the rRNA by attacking the rRNA and removing adenine
ricin
ricin
a toxin from castor beans, inactivates the rRNA by attacking the rRNA and removing adenine
What are the steps involved in protein synthesis?
- Formation of the protein initiation complex - Shine-Dalgarno sequence pairs with complementary bases of the rRNA on the small ribosome subunit - fMet-tRNAfmet is added at the peptidyl site (P site) 2. Large ribosome subunit joins the initiation complex 3. 2nd AA is placed at the aminoacyl site (A site) 4. Elongation - formation of the peptide chain 5. Protein synthesis is complete with the stop codon moving to the A site 6. Protein is released from the ribosome
What is the general structure of amino acids?
central alpha carbon with these attachments: * carboxylic group (COOH) amino group (NH2) * hydrogen atom * side chain (R group)
which form (isomer) of AA is found in human proteins?
L isomer - the AA has its amino group to the left
what is the chemical bond formed between amino acids?
peptide bond
what is glutathione?
plays a role in repairing oxidative damage to cell membrane
what is the composition of glutathione?
glutamate-cysteine-glycine
What is the primary structure of protein?
order of the AA residues
What is the secondary structure of proteins?
folding of the chain
What is the tertiary structure of proteins?
the 3D structure
What is the quaternary structure of proteins?
multi-subunit protein composed of discrete polypeptide subunits with non-covalent bonds
What are the 4 types of secondary structures in proteins?
* alpha helix * beta pleated sheet * beta turn * random coil
What are globular proteins?
- have a tertiary structure that resembles globes (e.g. globin) - generally are soluble in aqueous solutions
What are fibrillar proteins?
* have tertiary structure resembling rods (e.g. collagen) * generally insoluble in aqueous solutions
what is the final conformation of protein folding called?
native structure
chaperones
family of proteins that assist in the protein folding process
what are the 4 types of interactions/forces that exist during protein folding
- disulfide bonds - hydrophobic interactions - hydrogen bonds - ionic (electrostatic ) interactions
what are disulfide bonds?
covalent linkages are formed between -SH groups in cysteines to produce cystine (S-S bond)
which strutural level (s) does denaturation effect?
secondary, tertiary and quaternary structures
What are the prokaryotic DNA polymerases
Pol I, II, III
What are the eukaryotic DNA polymerases?
Pol alpha and delta
Histone mRNAs lack the …. and have a ….
poly A tail; very short half-life
Novobiocin
an antibiotic that blocks the binding of ATP (blocks type II topoisomerases)
Which topoisomerase requires ATP? Type I or Type II?
Type II
Nalidixic acid
-interferes with breakage and rejoining of DNA (inhibits gyrases) - an antibiotic used in urinary tract infections which are often resistant to more commonly used antibiotics
Abnormalities in formation of …-stranded DNA may lead to Hereditary Persistence of Fetal Hemoglobin. Transcription of the fetal hemoglobin chain is repressed by ….. If a mutation occurs, base change in the …, the … will not be able to form and fetal hemoglobin chain gene transcription continues.
Abnormalities in formation of triple stranded DNA may lead to Hereditary Persistence of Fetal Hemoglobin. Transcription of the fetal hemoglobin chain is repressed by triple-stranded DNA. If a mutation occurs (base change in the polypurines), the triple-helix will not be able to form and fetal hemoglobin chain gene transcription continues.
…-stranded DNA forms in the immunoglobulin genes that undergo recombination. This recombination of genes is responsible for antibody diversity. … is also present in the ends ….
Quadruplex DNA (four-stranded) forms in the immunoglobulin genes that undergo recombination. This recombination of genes is responsible for antibody diversity. Quadruplex DNA is also present in the ends of chromosomes - the telomeres.
3’- azido-2’, 3’-dideoxythymidine (AZT)
an inhibitor of reverse transcriptases, used in the treatment of AIDS
Rifampicin
an antibiotic that inhibits RNA Polymerase by binding to the β subunit
Creutzfeldt–Jakob disease (CJD)
- nervous system dysfunction including ataxia, dementia, and paralysis and is almost always fatal. - Fibrous amyloid-like plaques develop in the brain and cause degeneration
Creutzfeldt–Jakob disease (CJD) is believed to be caused by a misfolding in the
prion protein that changes the protein from its normal soluble cellular conformation to insoluble amyloid fibers.
True or False: The primers needed for DNA replication are short segments of RNA
True
All introns begin with a … sequence, which is the … site and end with …, the … site.
All introns begin with a GU sequence, which is the donor site and end with AG, the acceptor site.
During its processing the mRNA primary transcript becomes bound to…. … remove introns through splicing. Splice sites are determined by the … : … and ….
During its processing the mRNA primary transcript becomes bound to small nuclear ribonucleoproteins, called snRNPs or snurps. Snurps remove introns through splicing. Splice sites are determined by the snurps, U1RNA and U2RNA.
