Sample MCQ questions Flashcards
1) Which of the following is the name of the small self-replicating DNA molecule found in
bacteria that can be used as a cloning vector
a) Plasmid
b) Microsatellite
c) Chromatid
d) Amplicon
a) Plasmid
2) Which of the following is not correct in relation to DNA agarose gel electrophoresis
a) DNA migrates from the negative to the positive electrode
b) Smaller DNA molecules migrate slower than larger DNA molecules
c) Ultraviolet (UV) light is used to visualise the DNA bands in the gel
d) Ethidium bromide binds to the double stranded DNA
b) Smaller DNA molecules migrate slower than larger DNA molecules
3) What enzyme is used to seal the DNA sugar phosphate backbone between the cloning vector
DNA and the DNA insert during molecular cloning
a) DNA ligase
b) DNA sealing protein
c) Taq polymerase
d) DNA phosphatase
a) DNA ligase
4) What is the theoretical number of polymer chain reaction (PCR) amplicons expected after
forty cycles with a starting number of 1 target sequence
a) 40 X 2 X 1 = 80
b) 40 X 401 = 1600
c) 1 X 240 = 1,099,511,627,776
d) 40 X 12 = 40
c) 1 X 240 = 1,099,511,627,776
5) During a typical polymerase chain reaction (PCR) cycle DNA samples are first heated to 940C
and then cooled to 550C and then heated again to 720C. What are each of the different
temperature steps
a) 940C = DNA denaturation step 550C = enzyme extension step 720C = primer
annealing step
b) 940C = Primer annealing step 550C = DNA denaturation step 720C = enzyme
extension step
c) 940C = DNA denaturation step 550C = primer annealing step 720C = enzyme
extension step
d) 940C = Enzyme extension step 550C = DNA denaturation step 720C = primer
annealing step
c) 940C = DNA denaturation step 550C = primer annealing step 720C = enzyme
extension step
6) Which of the following is not a component of a typical PCR reaction
a) Taq DNA polymerase enzyme
b) ddATP, ddCTP, ddGTP, and ddTTP dideoxynucleotides
c) dATP,dCTP, dGTP, and dTTP nucleotides
d) synthetic single stranded oligonucleotide DNA primers
b) ddATP, ddCTP, ddGTP, and ddTTP
7) The method of sequencing DNA using dideoxynuclotide triphosphates (ddNTPs) is called
What
a) The Watson and Crick DNA sequencing method
b) The Sanger DNA sequencing method
c) The Pauling DNA sequencing method
d) The Mendel sequencing method
b) The Sanger DNA sequencing method
8) Which of the following is the correct name for the widely used gene that allows bacterial
colonies carrying a DNA insert to be selected during the molecular cloning process based on
their ability to metabolise the sugar X gal
a) LacZ
b) AmpR
c) Taq polymerase gene
d) DNA ligase gene
a) LacZ
9) What is the target region of a genome that is amplified during the polymerase chain reaction
(PCR)
a) Genomicon
b) Plasmid
c) Anticodon
d) Amplicon
d) Amplicon
10) EcoRI is a restriction enzyme that cuts DNA at a palindromic DNA sequence. Which of the
following DNA sequences is palindromic and is the restriction sequence for EcoRI
a) 5’ – GAATTC – 3’
3’- CTTAAG – 5’
b) 5’ – GGGGGG-3’
3’- CCCCCC- 5’
c) 5’-TAATAA-3’
3’- ATTATT- 5’
d) 5’- CACACA-3’
3’- GTGTGT-5’
a) 5’ – GAATTC – 3’
3’- CTTAAG – 5’
11) Which of the following nitrogenous bases is not found in biological DNA
a) Guanine
b) Adenine
c) Uracil
d) Cytosine
c) Uracil
12) What is the function of the enzyme DNA polymerases
a) Catalyses the synthesis of a new DNA molecule using a template DNA strand
b) Catalyses the synthesis of a new polypeptide molecules using a template DNA
strand
c) Catalyses the synthesis of a new RNA molecule using a template DNA strand
d) Catalyses the synthesis of a new polysaccharide molecule using a template DNA
strand
a) Catalyses the synthesis of a new DNA molecule using a template DNA strand
14) What is the full term for the acronym Mrna
a) Messenger ribose acid
b) Messenger ribonucleic acid
c) Messenger ribosome acid
d) Messenger restriction acid
b) Messenger ribonucleic acid
15) The biochemical process of translation is carried out by which molecule
a) DNA polymerase
b) RNA polymerase
c) The ribosome
d) DNA ligase
c) The ribosome
16) Which of the following will most dramatically change the amino acid sequence of a
Polypeptide
a) A single nucleotide substitution in the exon of a gene
b) Insertion of six nucleotides in the exon of a gene
c) A single nucleotide deletion in the exon of a gene
d) Deletion of three nucleotides in the exon of a gene
c) A single nucleotide deletion in the exon of a gene
17) Examine the coding DNA sequence of a gene below (note only one of the strands is shown).
A mutation has been discovered in this gene which changes a guanine nucleotide (G) to a
adenine nucleotide (A) (Note the mutation is highlighted in underline and bold). The coding
sequence of the normal gene and the mutated sequence of the gene are shown
Normal DNA sequence: TAC GGG CCC GTG
Normal mRNA sequence: AUG CCC GGG CAC
Normal polypeptide sequence: Met Pro Gly His
Mutant DNA sequence: TAC GG CCC GTA
Mutant mRNA sequence: AUG CCC GGG CAU
Mutant polypeptide sequence: Met Pro Gly His
a) A frameshift mutation
b) A missense mutation
c) A silent mutation
d) A nonsense mutation
c) A silent mutation
18) When snapdragon plants that produce red flowers are crossed with snapdragon plants that
produce white flowers the resulting offspring produce pink flowers. What Is the genetic term
used to describe this phenomenon
a) Complete dominance
b) Imperfect dominance
c) Codominance
d) Incomplete dominance
d) Incomplete dominance
19) Who is considered to be the father of genetics
a) Francis Crick
b) Gregor Mendel
c) James Watson
d) Charles Darwin
b) Gregor Mendel
20) What is the meaning of the genetic term epistasis
a) The situation when one gene has a multiple phenotypic effects
b) The situation when one gene alters the expression of another gene
c) The situation when a trait is controlled by one gene
d) The situation when a trait is controlled by one or more gene
b) The situation when one gene alters the expression of another gene
21) What is the correct description for a diploid organism with a pair of identical alleles for a
Character
a) Heterogeneous
b) Heterozygous
c) Homozygous
d) Homogeneous
c) Homozygous
22) Which of the following statements is true
a) Eukaryotic cells do not possess mitochondria in their cytoplasm
b) Prokaryotic cells do not contain proteins
c) Eukaryotic cells do not have a nuclear membrane
d) Prokaryotic cells do not have a nuclear membrane
d) Prokaryotic cells do not have a nuclear membrane
23) How many rounds of cell division take place in eukaryotic meiotic cell division
a) Two
b) One
c) Four
d) Three
a) Two
24) What is the missing phrase in the statement below? The chromatin in eukaryotic cell nuclei
consists of ——-
a) Protein and carbohydrates
b) Carbohydrates and enzymes
c) Deoxyribonucleic acid and carbohydrates
d) Deoxyribonucleic acid and protein
d) Deoxyribonucleic acid and protein
25) If mottled overo stallions are matted with mottled overo mares what would the phenotypic
proportions of foals born
a) 25% mottled overo foals 50% solid coloured foals 25% pure white still born foals
b) 50% mottled overo foals 25% solid coloured foals 25% pure white still born foals
c) 25% mottled overo foals 25% solid coloured foals 50% pure white still born foals
d) 33.3% mottled overo foals 33.3% solid coloured foals 33.3% pure white still born foals
b) 50% mottled overo foals 25% solid coloured foals 25% pure white still born foals
26) A scientist crosses two true breeding varieties of pea plant. The first variety consists of
plants that always produce yellow and round seeds. The second variety consists of plants
that always produce green and wrinkled seeds. The F1 hybrid mating consists of plants that
produce yellow and round seeds. What is the expected ratio of phenotypes in the F2
generation that is produced from mating the F1 plants with each other
a) 9 Green Wrinkled 3 Yellow Wrinkled 3 Green Round 1 Yellow Round
b) 9 Yellow Wrinkled 3 Yellow Round 3 Green Wrinkled 1 Green Round
c) 9 Green Round 3 Yellow Round 3 Green Wrinkled 1 Yellow Wrinkled
d) 9 Yellow Round 3 Yellow Wrinkled 3 Green Round 1 Green Wrinkled
d) 9 Yellow Round 3 Yellow Wrinkled 3 Green Round 1 Green Wrinkled
28) What does r RNA stand for
a) Reproducible RNA
b) Replicated RNA
c) Regular RNA
d) Ribosomal RNA
d) Ribosomal RNA
29) Which of the following statements correctly describes complementary base pairing in DNA
A) Guanine base (G) is always base paired with cytosine C via two hydrogen bonds
B) Guanine base is always paired with adenine (A) base via two hydrogen bonds
C) A thymine base (T) is always base paired with adenine via two hydrogen bonds
D) A thymine base is always paired with cytosine base via three hydrogen bonds
C) A thymine base (T) is always base paired with adenine via two hydrogen bonds
30) What is the correct definition of the term cell cycle
a) The energy production system in a eukaryotic cell
b) The translation and transcription of encoded genetic information
c) The circular chromosome found in prokaryotic bacterial cells
d) The series of events in a eukaryotic cell from one cell division to the next
d) The series of events in a eukaryotic cell from one cell division to the next
31) The ovine haploid chromosome number is 27. Ignoring recombination how many
chromosomal combinations can result during meiotic cell division in sheep
a) 729
b) 54
c) 134,217,728
d)443,426,488,243,038,000,000,000,000,000,000,000,000
c) 134,217,728
32) What is the term used to describe the genotype of an X linked gene in male mammals
a) Homozygous
b) Heterozygous
c) Hemizygous
d) Homogeneous
c) Hemizygous
33) What is the correct definition of the term pleiotrophy
a) The action of one gene modifying the effects of other genes
b) The movement of the spindle during eukaryotic cell division
c) The genetic effect of a single gene on multiple phenotypic traits
d) The genetic exchange that takes place between homologous chromosones during
prophase I of meitotic cell division
c) The genetic effect of a single gene on multiple phenotypic traits
34) Which of the following processes can enhance the evolutionary adaptation of a species to its
Environment
a) Mutation
b) Gene flow
c) Genetic drift
d) Natural or artificial selection
d) Natural or artificial selection
35) The frequency of cystic fibrosis (a recessive genetic disorder) in Ireland is approximately 1 in
1600. Therefore assuming Hardy-Weinberg Equilibrium which of the answers below
represents the best estimate of the frequency of the mutant cystic fibrosis allele in the Irish
population
a) 0.250
b) 0.025
c) 0.050
d) 0.500
b) 0.025
36) Who first developed the concept of the genetic linkage map
a) James Watson and Francis Crick
b) Gregor Mendel
c) Thomas Hunt Morgan and Alfred Sturtevant
d) Linus Pauling
c) Thomas Hunt Morgan and Alfred Sturtevant
37) A colour blind woman has children with a man who has normal vision. What are the
expected offspring proportions from this mating
a) 50% carrier females 50% colour blind males
b) 50% normal females 50% colour blind males
c) 50% colour blind females 50% normal males
d) 50% carrier females 50% normal males
a) 50% carrier females 50% colour blind males
38) S Wright, J.B.S Haldane and R.A fisher initiated which branch of genetics
a) Molecular genetics
b) Population genetics
c) Plant genetics
d) Animal genetics
b) Population genetics
39) In a region of west Africa with a high incidence of malaria, the frequency of sickle cell
anaemia (a recessive genetic disorder) in the human population is 1 in 30. Therefore
assuming Hardy Weinberg Equation (HWE) which of the
answers below represents the best estimate of the mutant
sickle cell anaemia in this population
a) 0.06
b) 0.18
c) 0.30
d) 0.03
b) 0.18
40) Scientific evidence suggests that the cheetah (Acinoyx Jubatus) has undergone how many
population constrictions that led to reductions in genetic variation
a) 2
b) 1
c) 3
d) None
a) 2
41) An evolutionary founder event will act to
a) Decrease genetic drift
b) Increase rate of mutation
c) Increase genetic drift
d) Decrease the rate of mutation
c) Increase genetic drift
42) Which of the following is the correct definition of the term genetic linkage
a) Two genes on different chromosomes that have a chemical bridge between them
b) The relationship between two genes that are physically close on the same chromosome
and tend to be transmitted from parents to offspring as a single unit
c) Two genes that influence the same phenotypic trait
d) The condensation of chromatin to form discrete chromosomes prior to cell division
b) The relationship between two genes that are physically close on the same chromosome
and tend to be transmitted from parents to offspring as a single unit
43) Which of the following nitrogenous bases is not found in biological DNA
a) Adenine
b) Cytosine
c) Guanine
d) Uracil
d) Uracil
44) Which of the following are removed from transcribed protein coding RNA during mRNA
processing in eukaryotes
a) Axons
b) Protons
c) Exons
d) Introns
d) Introns
45) Which of the following is not thought to cause mutation in the sequence or structure of DNA
Molecules
a) Exposure to chemical mutagen
b) Exposure to X Ray radiation
c) Exposure to a magnetic field
d) Exposure to Ultra Violet (UV) radiation
c) Exposure to a magnetic field
46) The biochemical process of transcription is carried out by which molecule
a) Restriction enzyme
b) RNA polymerase
c) The ribosome
d) DNA ligase
b) RNA polymerase
47) The ribosome is composed of
a) Protein and DNA
b) Protein and RNA
c) Carbohydrate and RNA
d) Protein and Carbohydrate
a) Protein and DNA
48) Which of the following discovered the three dimensional structure of DNA
a) Gregor Mendel
b) James Watson and Francis Crick
c) Oswald Avery
d) Charles Darwin
b) James Watson and Francis Crick
49) Which of the following terms does not relate to the structure of DNA
a) Hydrogen bond
b) Purine
c) Pyrimidine
d) Peptide
d) Peptide
50) What is the function of the retroviral enzyme reverse transcriptase
a) Enables virus to enter cellular membranes of host cell
b) Translates host DNA into viral proteins
c) Transcribes a DNA molecule from a single stranded viral RNA template
d) Lyses cell membrane to allow viral particles infect other cells
c) Transcribes a DNA molecule from a single stranded viral RNA template
51) Which of the following is not correct in relation to DNA agarose gel electrophoresis
a) Ethidium Bromide binds to double stranded DNA
b) DNA migrates from the positive electrode to the negative electrode
c) Smaller DNA molecules migrate faster than larger DNA molecules
d) UV light is used to visualise the DNA bands in the gel
b) DNA migrates from the positive electrode to the negative electrode
53) What is the Sanger laboratory method used for
a) Determining the sequence of bases in a DNA molecule
b) Cutting a DNA molecule into smaller fragments
c) Transcribing An RNA molecule from a DNA template molecule
d) Translating and RNA molecule into a polypeptide chain
a) Determining the sequence of bases in a DNA molecule
54) What is the theoretical number of polymerase chain reaction (PCR) amplicons expected after
40 cycles with a starting number of 10 sequences
a) 40 X 210 = 40, 960
b) 40 X 102= 4,000
c) 2 X 1040= 20,000,000,000,000,000,000,000,000,000,000,000,000
d) 10 X 240= 10, 995, 116, 277, 760
d) 10 X 240= 10, 995, 116, 277, 760
55) Which of the following is the correct name for a widely used gene that confers resistance to
an antibiotic during bacterial cloning of recombinant DNA
a) ampR
b) andR
c) anpR
d) amaR
a) ampR
56) Which of the following is the correct name for a widely used gene that metabolises X gal and
differentiates recombinant from non recombinant plasmids during bacterial cloning of
recombinant DNA
a) LucZ
b) lacZ
c) licZ
d) locZ
b) lacZ
57) Which of the following methods is not used to produce transgenic animals
a) Microinjection of foreign DNA into embryo pro nuclei
b) Replacement of an oocyte nucleus with the nucleus of a transgenic donor cell
c) Injection of DNA molecules into an animals blood circulatory system using a hypodermic
syringe
d) Use of modified retroviruses as vectors to carry genes into an embryo
1 2 3 4 5
c) Injection of DNA molecules into an animals blood circulatory system using a hypodermic
syringe
58) Which of the following bacterial species can be used to produce transgenic plants using
recombinant TI plasmids
a) Escherichia Coli
b) Haemophilus influenza
c) Staphylococcus aureus
d) Agrobacterium tumefaciens
d) Agrobacterium tumefaciens
59) What does the Ti stand for in Ti plasmid
a) Transcript inducing
b) Tumour inducing
c) Transgene inducing
d) Trait inducing
b) Tumour inducing
60) Transgenic golden rice was developed to alleviate deficiency of what vitamin in certain
human populations
a) Vitamin A
b) Vitamin B
c) Vitamin C
d) Vitamin D
a) Vitamin A
61) Which of the following processes does not occur in the eukaryotic cells nucleus
a) DNA replication
b) Translation
c) RNA processing
d) Transcription
b) Translation
62) With respect to population genetics, a gene pool consists of
a) The total of all alleles across all genetic loci in a population
b) The entire genome of a reproducing individual
c) All the gametes in a population
d) Only those alleles in a population subject to natural selection
a) The total of all alleles across all genetic loci in a population
63) What was the mechanism of the evolution of species proposed by Charles Darwin in the
Origin of Species published in 1859
a) Mutation
b) Genetic Drift
c) Natural Selection
d) Random Mating
c) Natural Selection
64) Which of the following statements is not true of a codon
a) Its consists of three nucleotides
b) It may code for more than one amino acid
c) It never codes for one or more amino acids
d) It’s the basic unit of genetic code
b) It may code for more than one amino acid
65) Which of the following cellular components is not involved in the process known as
Translation
a) Mature mRNA
b) tRNA
c) RNA polymerase
d) Ribosomes
c) RNA polymerase
66) The anticodon of a particular tRNA molecule is
a) The part of the tRNA molecule that bonds to a specific amino acid
b) Complementary to the corresponding m RNA molecule
c) The part of the t RNA molecule that binds to the ribosome
d) Complementary to the corresponding nucleotide triplet in r RNA
b) Complementary to the corresponding m RNA molecule
67) What is the size of the haploid human genome in base pairs
a) 3.2 kilo base pairs (kbp)
b) 3.2 mega base pairs (Mbp)
c) 6.4 Giga base pairs (Gbp)
d) 3.2 Giga base pairs (Gbp) = (Giga = 1 billion = 1X109)
d) 3.2 Giga base pairs (Gbp) = (Giga = 1 billion = 1X109)
68) The combined human genome consists of the nuclear genome and the
a) Ribosomal genome
b) The golgi apparatus genome
c) The mitochondrial genome
d) The chloroplast genome
c) The mitochondrial genome
69) What is meant by the term genetic drift
a) The random fluctuations in a populations genetic structure due to chance over time
b) The increase in frequency of a beneficial allele in a population over time
c) The decrease in frequency of a deleterious allele in a population over time
d) The observation that heterozygous individuals at a given genetic locus are better
adapted to their environment than either homozygote
b) The increase in frequency of a beneficial allele in a population over time
70) Examine the following mature m RNA sequence 5’ AUG-AAA-GCG-UUU-UGA-3’. Using
genetic code what is the correct sequence of amino acids specified by this frame
a) MET – ALA – VAL – PHE- GLY – STOP
b) MET – LYS – ALA- SER – PHE – STOP
c) MET – THR – PRO – LEU – CYS- STOP
d) MET – ASP – VAL – SER – PHE – STOP
b) MET – LYS – ALA- SER – PHE – STOP
71) Genetic studies have revealed a dearth of genetic variation in the Northern Elephant Seal
populations. What is the major contributing factor that has resulted in this lack of variation?
a) A major population founder effect in the 19th Century
b) A major population bottleneck effect in the 19th Century
c) No genetic mutations have occurred in the Northern elephant seal population since the
19th century
d) Natural selection has removed much of the genetic variation in this population since the
19th century
b) A major population bottleneck effect in the 19th Century
72) Which of the following force of microevolution permits populations to become better
adapted to their environment
a) Natural Selection
b) Genetic Drift
c) Mutation
d) Gene Flow
a) Natural Selection
79) Flower colour in peas is controlled by a single gene for which there are two alleles P=Purple
and p=white. Purple flower colour is dominant to white. The plant is homozygous for purple
and for white flowers. What are the expected genotype frequencies of the offspring
a) All offspring will have a Pp genotype
b) PP: pp 1:1
c) PP:pp 3:1
d) PP:Pp:pp 3:3:1
a) All offspring will have a Pp genotype
80) What is the term used to describe the genetic phenomenon whereby a single gene can have
multiple phenotypes
a) Epistasis
b) Complete dominance
c) Pleiotropy
d) Codominance
c) Pleiotropy
81) Hameophillia A is a blood clotting disorder caused by the mutation in the factor VII blood
gene. Which of the following statements is true
a) Hameophillia A is an autosomal dominant genetic disorder that affects males and
females with the same severity and frequency
b) Hameophillia A is an X linked recessive genetic linked disorder that affects females more
frequently than males
c) Hameophillia A is an X linked recessive genetic linked disorder that affects males and
females with the same severity and frequency
d) Haemophilia A is an X linked recessive genetic disorder that affects males more severely
and frequently than females
d) Haemophilia A is an X linked recessive genetic disorder that affects males more severely
and frequently than females
82) A point mutation which causes the reading frame of m RNA molecule to be altered is called
a) Frameshift mutation
b) Silent mutation
c) A missense mutation
d) Nonsense mutation
a) Frameshift mutation
83) Which of the following physical and chemical agents is not a mutagen
a) UV light
b) Heat
c) X Ray
d) Atomic radiation
b) Heat
84) What enzyme is responsible for synthesising m RNA under the direction of the genes DNA
Sequence
a) DNA polymerase
b) RNA polymerase
c) RNA primase
d) The ribosome
b) RNA polymerase
85) How many stop codons are there in the genetic code
a) 2
b) 4
c) 3
d) 1
c) 3
86) Which of the following is not a condition of the Hardy Weinberg Theorem
a) Mutation must occur in a population
b) The population must be very large
c) No natural selection occurs in the population
d) Random mating is occurring in the population
a) Mutation must occur in a population
87) The biochemical process of transcription is carried out by which molecule
a) Restriction enzyme
b) RNA polymerase
c) The ribose
d) DNA ligase
b) RNA polymerase
88) How many start and stop codons are there in the genetic code
a) 4
b) 3
c) 5
d) 2
a) 4
89) What is the name given to a model of DNA replication whereby the two DNA strand parental
molecule separate and each single strand then functions as a template for the new
complementary strand
a) Conservative replication
b) Semi conservative replication
c) Dispersive replication
d) Liberal replication
b) Semi conservative replication
90) What molecule if responsible for transferring the correct amino acid at the size of translation
a) Translocation RNA
b) Transfer DNA
c) Transfer RNA
d) Transform RNA
c) Transfer RNA
91) There is a mutant allele in a gene that controls eye shape in Drosophilia termed gl (wild type
allele: gl+) that is located in Drosophilia chromosome three. Flies homozygous for the mutant
allele have small smooth egg shaped eyes (glass eyes). There is also a mutant allele in a gene
that controls the number of hairs on the body of Drosophilia flies termed h (wild type allele
h+). This gene is also located on Drosophillia chromosome 3. Flies homozygous for the
mutant allele have much harrier bodies than normal flies.
A cross is carried out as follows
A doubly heterozygous female (gl+g h+h) is crossed with a doubly homozygous recessive male
(gl gl h h) and the following offspring numbers are obtained
* gl+ gl h+ h Normal eyes normal body 330
* gl gl h h Glass eyes hairy body 320
* gl+ gl h h Normal eyes hairy body 180
* gl gl h+ h Glass eyes normal body 170
What is the recombination frequency between these two genes?
a) 0.35
b) 0.65
c) 0.50
d) 0.05
a) 0.35
92) Which of the following is not involved in translation
a) Mature mRNA
b) T RNA
c) RNA polymerase
d) Ribosomes
c) RNA polymerase
93) Under the assumption of the Hardy Weinberg Equation (HWE) what would be the expected
genotypic frequencies for a gene with two alleles (A and a) where the frequency of A allele p
is 0.60 and the frequency of the a allele q is 0.40
a) Frequency of ‘AA’=0.16 Frequency of ‘aa’=0.36 Frequency of ‘Aa’=0.48
b) Frequency of ‘AA’=0.48 Frequency of ‘aa’=0.16 Frequency of ‘Aa’=0.36
c) Frequency of ‘AA’=0.36 Frequency of ‘aa’=0.16 Frequency of ‘Aa’= 0.48
d) Frequency of ‘AA’=0.36 Frequency of ‘aa’=0.48 Frequency of ‘Aa’=0.16
c) Frequency of ‘AA’=0.36 Frequency of ‘aa’=0.16 Frequency of ‘Aa’= 0.48
94) The bovine haploid number is 30. Ignoring recombination how many chromosomal
combinations can result during meiotic cell division in cattle
a) 60
b) 30
c) 1,073,741,824 (i.e.230)
d) 900
c) 1,073,741,824 (i.e.230)
95) The anticodon of a particular TRNA molecule is
a) The part of the TRNA molecule that bonds to a specific amino acid
b) Complementary to the corresponding m RNA codon
c) The part of the TRNA molecule that binds to the ribosome
d) Complementary to the corresponding nucleotide triplet in a gene’s DNA sequence
b) Complementary to the corresponding m RNA codon
96) Which of the following codon sequences represents the eukaryotic START codon
a) CCU
b) UUU
c) AUG
d) AAA
c) AUG
97) What does DNA stand for
a) Disulfiderderibonucleic acid
b) Deoxyribonucleic acid
c) Dideoxyribonucleic acid
d) Dueteriumribonucleic acid
b) Deoxyribonucleic acid
98) James Watson and Francis Crick along with Maurice Wilkins won the Nobel Prize in 1962 for
what scientific breakthrough reported in 1953
a) The discovery of DNA in genetic material
b) The elucidation of the genetic code
c) The elucidation of the 3 dimensional structure of DNA
d) A method to sequence DNA
c) The elucidation of the 3 dimensional structure of DNA
99) Which of the following best describes during the metaphase of mitosis
a) The cells chromosomes (in the form of sister chromatids) align along a central plain in
the dividing cell
b) The cells genetic material is replicated
c) The cells genetic material condenses into chromosomes
d) The cells cytoplasm replicates
a) The cells chromosomes (in the form of sister chromatids) align along a central plain in
the dividing cell
100) During the cell cycle when is the cells genetic material (i.e. the genome) replicated
a) G1 Phase
b) G2 Phase
c) S Phase
d) M Phase
c) S Phase
101) Colour blindness in humans is an X linked recessive disorder. A female who is colour
blind marries a colour blind man. If the couple have children what will the phenotypes of the
offspring be
a) All children will be colour blind
b) None will be colour blind
c) Only male children will be colour blind
d) Only female children will be colour blind
a) All children will be colour blind
102) When short horn cattle with red coat colour are bred with short horn cattle with
white coat the resulting progeny all display roan coat colour in which red hairs are
intermingled with white hairs. This genetic phenomenon is an example of
a) Pleiotropy
b) Complete dominance
c) Blending inheritance
d) Co-dominance
d) Co-dominance
103) What is mitosis
a) A form of cell division in which a diploid parent cell gives rise to four genetically identical
haploid gametes
b) A form of cell division in which a diploid parent gives rise to two genetically identical
daughter cells
c) A form of cell division in which a diploid parent gives rise to four genetically different
haploid gametes
d) A stage of the cell cycle where the cells genetic material is replicated
b) A form of cell division in which a diploid parent gives rise to two genetically identical
daughter cells
104) Which of the following is not a function of mitosis
a) Cell repair
b) Gamete production
c) Organism growth
d) Organism development
b) Gamete production
105) Which of the following best describes the composition of chromatin
a) DNA only
b) Protein only
c) A complex of DNA and protein
d) Complex of protein and polysaccharide
c) A complex of DNA and protein
106) What is the name of the pentose sugar found in DNA
a) Deoxyribose
b) Ribose
c) Dideoxyribose
d) Deoxyglucose
a) Deoxyribose
107) What is the name of the organelle that facilitates the translation of messenger RNA
into a polypeptide
a) Mitochondrion
b) Ribosome
c) Golgi apparatus
d) Centrioles
b) Ribosome
108) What is meiosis
a) A form of cell division in which a diploid parent cell gives rise to four genetically identical
haploid gametes
b) A form of cell division in which a diploid parent cell gives rise to four genetically different
haploid gametes
c) A stage of the cell cycle where the cells genetic material is replicated
d) A form of cell division where two genetically identical diploid daughter cells are
produced
b) A form of cell division in which a diploid parent cell gives rise to four genetically different
109) With respect to human genetics which of the following regarding the human
chromosome number is true
a) The haploid number (n) of human chromosome is 46
b) The diploid number (2n) of human chromosome is 23
c) The diploid number 2n of human chromosome is 30
d) The haploid number n of human chromosome is 23
d) The haploid number n of human chromosome is 23
110) Which of the following does not contribute to the genetic variation that arises
between generations
a) Independent assortment of chromosomes during meiosis
b) The crossing over of non -sister chromatids during meiosis
c) Random fertilisation of gametes
d) The crossing over of sister chromatids during meiosis
d) The crossing over of sister chromatids during meiosis
111) A point mutation which causes the reading frame of messenger RNA molecule to be
altered is called
a) A frame-shift mutation
b) Silent mutation
c) A missense mutation
d) A nonsense mutation
a) A frame-shift mutation
112) What molecule is responsible for transferring the correct amino acid at the site of a
codon during translation
a) Messenger RNA
b) Small RNA
c) Transfer RNA
d) Ribosomal RNA
c) Transfer RNA
113) Who wrote the book on the origin of the species
a) Gregor Mendel
b) Charles Darwin
c) James Watson
d) Francis Crick
b) Charles Darwin
114) The frequency of a recessive genetic disease causing allele q in a population is
estimated at 0.2. The population is comprised of 1000 individuals. Assuming Hardy Weinberg
Equation how many individuals are predicted to be affected by the disorder.
a) 40
b) 140
c) 100
d) 60
a) 40
115) Positive natural selection will act to
a) Decrease the frequency of favourite allele in a population
b) Increase the frequency of a favourite allele in a population
c) Have no effect on the allele frequency in a population
d) None of the above
b) Increase the frequency of a favourite allele in a population
116) What’s the most extreme form of inbreeding
a) Self -fertilisation
b) Mating between brother and sister
c) Mating between parent and child
d) All of the above
a) Self -fertilisation
What is Microevolution?
Microevolution is the change in allele/and or genotype frequencies of a population
from one generation to the next
118) What’s the phenomenon called where some transfer RNA anticodons recognise two
or more different codons
a) Topple
b) Wobble
c) Bobble
d) None of the above
b) Wobble
119) Which of the following best represents the correct sequence of events during the
process of gene expression
a) DNA – RNA – polypeptide – protein
b) RNA – DNA – protein – polypeptide
c) Protein – polypeptide – RNA – DNA
d) Polypeptide – protein – RNA – DNA
a) DNA – RNA – polypeptide – protein
120) What insect is considered to be the workhorse of genetics
a) The fruit fly
b) Blue bottle
c) Green Fly
d) Dragonfly
a) The fruit fly (Drosophilia Monogaster)
121) Who first developed the concept of the genetic map
a) Gregor Mendel
b) James Watson and Thomas Crick
c) Thomas Hunt Morgan and Alfred Sturtevant
d) Charles Darwin
c) Thomas Hunt Morgan and Alfred Sturtevant
Which of the following statements are true?
a-Prokaryotic cells do not contain proteins
b-Prokaryotic cells do not have a nuclear membrane
c-Eukaryotic cells do not have a nuclear membrane
d-Eukaryotic cells do not possess ribosomes in their cytoplasm.
e-Eukaryotic cells do not possess mitochondria in their cytoplasm.
b-Prokaryotic cells do not have a nuclear membrane
The domestic cat has a diploid chromosome number of 38. Ignoring the genetic recombination, how many chromosomal combinations are possible in haploid cat gametes (eggs and sperm)
a-1,444
b-76
c-2,085,136
d-524,288
e-274,877,906,944
e-274,877,906,944
What is the full term for the acronym mRNA
a-Messenger ribonucleic acid
b-Messenger ribosome acid
c-Messenger ribose acid
d-Messenger restriction acid
e-Messenger recombinant acid
a-Messenger ribonucleic acid
If a snapdragon plant with red flowers is mated with a snapdragon plant with pink flowers, what are the expected proportions of phenotypes in the progeny?
a-50% of the progeny will be plants with red flowers and 50% of the progeny will be plants with white flowers.
b-100% of the progeny will be plants with red flowers.
c-50% of the progeny will be plants with red flowers and 50% of the progeny will be plants with pink flowers.
d-100% of the progeny will be plants with pink flowers
e-25% of the progeny will be plants with red flowers, 50% of the progeny will be plants with pink flowers, and 25% of the progeny will be plants white
c-50% of the progeny will be plants with red flowers and 50% of the progeny will be plants with pink flowers.
What is the function of the enzyme DNA polymerase?
a-Catalyses the synthesis of a new DNA molecule using a template RNA strand.
b-Catalyses the synthesis of a new polysaccharide molecule using a template DNA strand.
c- Catalyses the synthesis of a new RNA molecule using a template DNA strand.
d-Catalyses the synthesis of a new polypeptide molecule using a template DNA strand.
e-Catalyses the synthesis of a new DNA molecule using a template DNA strand.
e-Catalyses the synthesis of a new DNA molecule using a template DNA strand.
If a shorthorn bull with a solid red coat is mated with a shorthorn cow with a roan coat, what are the expected proportions of offspring?
a-50% of calves will have solid red coats and 50% of the calves will have solid white coats.
b-100% of calves will have solid red coats.
c-50% of calves will have roan coats and 50% will have solid white coats.
d-25% of calves will have solid red coats, 50% will have roan coats and 25% will have solid white coats.
e-50% of calves will have solid red coats and 50% of calves will have roan coats.
e-50% of calves will have solid red coats and 50% of calves will have roan coats.
7)What is the missing phrase in the statement below?
The chromatin in eukaryotic cell nuclei consists of_______
a-Protein and carbohydrates.
b-Deoxyribonucleic and (DNA) and lipids.
c- Deoxyribonucleic and (DNA) and protein.
d-Protein and lipids.
e- Deoxyribonucleic and (DNA) and carbohydrates.
c- Deoxyribonucleic and (DNA) and protein.
A scientist crosses two true-breeding varieties of pea plant. The first variety consists of plants that always produce yellow and round seeds. The second variety consists of plants that always produce green and wrinkled seeds. The F1 hybrid offspring from this mating consist of plats that all produce yellow and round seeds. What is the ratio of phenotypes in the F2 generation that is produced by mating the F1 plants with each other?
a- 9 green wrinkled: 3 yellow wrinkled: 3 Green round: 1 Yellow round.
b- 9 yellow wrinkled: 3 Yellow round: 3 Green wrinkled: 1 Green round.
c- 9 Yellow round: 3 yellow wrinkled: 3 Green round: 1 Green wrinkled.
d- 9 Green wrinkled: 3 Yellow round: 3 Green round: 1 Yellow wrinkled.
e- 9 Green round: 3 Yellow round: 3 Green round: 1 Yellow wrinkled.
c- 9 Yellow round: 3 yellow wrinkled: 3 Green round: 1 Green wrinkled.
There is a mutant allele in a gene that controls eye shape in Drosophilae termed gl (wild type allele: gl*) that is located on Drosophilae chromosome three. Flies homozygous for the mutant allele have small smooth egg- shaped eyes (‘glass eyes’).
There is also a mutant allele in a gene that controls the number of hairs on the body of Drosophila flies termed h (wild type allele: h+). This gene is also located on Drosophila chromosome three. Flies homozygous for the mutant allele have much harrier bodies than normal flies.
A cross is carried out as follows:
A doubly heterozygous female (gl+ gl h+ h) is crossed with a doubly homozygous recessive make (gl gl h h) and the following offspring numbers are obtained:
gl+ gl h+ h (Normal-eyes-normal-body):330
gl gl h h (Glass-eyes-hairy-body):320
gl+ gl h h (Normal-eyes-hairy-body):180
gl gl h+ h (Glass-eyes-normal body):170
What is the recombination frequency between these two genes?
a-0.65
b-0.05
c-0.35
d-0.30
e-0.50
c-0.35
The biochemical process of translation is carried out by which complex macromolecule?
a-RNA polymerase
b-DNA helicase.
c-DNA ligase.
d-DNA polymerase
e-The ribosome.
e-The ribosome.
A colour blind woman has children with a man who has normal vision. What are the expected offspring proportions from this mating?
(NB: colour-blindness is a sex linked trait)
a-25% normal females: 25% carrier females: 50% colour-blind males.
b-50% colour blind females: 50% normal males.
c-50% carrier females: 50% colour-blind males.
d-50% carrier females: 50% normal males.
c-50% carrier females: 50% colour-blind males.
How many rounds of nuclear division take place in eukaryotic meiotic cell nuclear division?
a-Three
b-One.
c-None.
d-Four.
e-Two.
e-Two.
Which of the following is the correct definition of the term ‘genetic linkage’?
a-The relationship between two genes that are physically close on the same chromosome and tend to be transmitted from parents to offspring as a single unit.
b-Two genes that influence the same phenotypic trait.
c-The condensation of chromatin to form discrete chromosomes prior to cell division.
d-Two genes on different chromosomes that have a chemical bridge between them.
a-The relationship between two genes that are physically close on the same chromosome and tend to be transmitted from parents to offspring as a single unit.
What is the correct description for a diploid organism with a pair of identical alleles for a character?
a- Homogenous
b- Homologous
c- Heterozygous
d-Homozygous
e-Heterogeneous
d-Homozygous
In 2050, NASA scientists obtain samples of bacteria-like cells collected by a space probe from the subsurface ocean on Europa, one of the moons of the planet Jupiter.
When the scientist analyses the biochemistry of these alien cells they observe that they possess DNA identical to the DNA molecules found in biological like on Earth with the same four deoxyribonucleotides containing adenine (A), cytosine (C), guanine(G) and thymine(T). However, further investigation by the scientist’s reveals, to their amazement, that these cells synthesise polypeptide chains using a much larger number of amino acids- a total of 120 chemically distant amino acids.
From this information, the scientists deduce that these cells are most likely to use an expanded redundant genetic code consisting of DNA codon ‘words’ with how many nucleotide ‘letters’?
a- Five nucleotide “letters”
b- Four nucleotide “letters”
c- Eight nucleotide “letters”
d- Three nucleotide “letters”
e- Six nucleotide “letters”
d- Three nucleotide “letters”
Who of the following is considered the ‘Father of Genetics’?
a- Charles Darwin.
b-Francis Crick.
c-Gregor Mendel.
d-James Watson.
e-Alfred Russel Wallace.
c-Gregor Mendel.
What is the term used to describe the genotype of an X-linked gene in male mammals?
a-Heterozygous.
b-Homogeneous.
c-Heterologous.
d-Hemizygous.
e-Homozygous.
d-Hemizygous.
Who first developed the ‘genetic map’?
a-Linus Pauling.
b-Gregor Mendel.
c-Oswald Avery, Colin MacLeod and Maclyn McCarty.
d-James Watson and Francis Crick
e-Thomas Hunt Morgan and Alfred Sturtevant.
e-Thomas Hunt Morgan and Alfred Sturtevant.
Which of the following nitrogenous is not found in biological DNA?
a-Cytosine.
b-Adenine.
c-Thymine.
d-Guanine.
e-Uracil.
e-Uracil.
During the early phase of Drosophila melanogaster development, the multinucleated cell generated by multiple divisions is termed the…
a-Coelacanth.
b-Cytoplasm.
c-Coenocyte.
d-Centrosome.
e-Centromere.
c-Coenocyte.
The testis determining factor protein (TDF) determines whether a mammalian zygote develops into a male. Which chromosomes contains the gene that encodes the TDF protein?
a- The B chromosome.
b- The X chromosome.
c- The Y chromosome.
d- The W chromosome.
e- The Z chromosome.
c- The Y chromosome.
For the human ABO blood group system, which blood group is considered to be the ‘universal recipient’ for blood transfusions?
a- Blood group A.
b- Blood group O.
c- Blood group AB.
d- Blood group MN.
e- Blood group B.
c- Blood group AB.
What percentage of transgenic o<spring would be expected using transgenesis bytransfer of transfected nuclei?
a. 50%
b. 100%
c. 1-5%
d. 25%
e. 0%
c. 1-5%
How many rounds of cell nuclear division take place in eukaryoc meiosis?
a. None
b. One
c. Two
d. Four
e. Three
d. Four
A coenocyte is…
a. The cell type responsible for gametogenesis
b. The fertilised zygote before the sperm and egg pronuclei combine to form a single diploid nucleus
c. A multinucleated cell generated from multiple nuclear divisions without cytokinesis
d. A mulicellular organism
e. A single-celled organism
c. A multinucleated cell generated from multiple nuclear divisions without cytokinesis
What is the 5’ to 3’ DNA sequence of the original template strand used for the sequencing reaction shown on the autoradiogram below? Hint: the autoradiogram shows the newly synthesised complementary strand
a. 5’ AATGATCGTGCC 3’
b. 5’ TTACTAGCACGG 3’
c. 5’ UUACUAGCACGG 3’
d. 5’ GGCAGCAUCAUU 3’
e. 5’ GGCACGATCATT 3’
e. 5’ GGCACGATCATT 3’
The following diagram shows the temperature profile for the start of a typical polymerase chain reaction (PCR). What is the correct temperature at Temp B?
a. 55°C
b. 72°C
c. 82°C
d. 95°C
e. 62°C
b. 72°C
What is the theoretical number of polymerase chain reaction (PCR) amplicons expected after 35 cycles with a starting number of 20 target sequences?
a. 35 x 220 = 40,960
b. 35 x 202 = 4,000
c. 20 x 235 = 687,194,767,360
d. 2 x 2035 = 6,871,947,673,600,000,000,000,000,000,000,000,000,000,000,000
e. 35 x 20 = 700
c. 20 x 235 = 687,194,767,360
The dwarf phenotype in Dexter cattle is associated with a lethal recessive allele. The lethal recessive condition is termed ‘bulldog’, which gives rise to stillborn calves with severe facial deformities. Male dwarf Dexter cattle are crossed with female dwarf Dexter cattle. What would be the expected phenotypic proportions of the offspring produced?
a. 25% dwarf calves | 50% normal-sized calves | 25% stillborn ‘bulldog’ calves
b. 50% dwarf calves | 25% normal-sized calves | 25% stillborn ‘bulldog’ calves
c. 25% dwarf calves | 25% normal-sized calves | 50% stillborn ‘bulldog’ calves
d. 33.3% dwarf calves | 33.3% normal-sized calves | 33.3% stillborn ‘bulldog’ calves
e. 50% normal-sized calves | 50% stillborn ‘bulldog’ calves
b. 50% dwarf calves | 25% normal-sized calves | 25% stillborn ‘bulldog’ calves
Which of the following is the correct description of the ABO blood group system in humans?
a. The human ABO blood group system is controlled by three genes
b. The human ABO blood group system is controlled by a single gene with two recessive alleles and one dominant allele
c. The human ABO blood group system is controlled by a single gene with two codominant alleles and one lethal allele
d. The human ABO blood group system is controlled by two genes
e. The human ABO blood group system is controlled by a single gene with two codominant alleles and one recessive allele
e. The human ABO blood group system is controlled by a single gene with two codominant alleles and one recessive allele
What is the correct definition of the term ‘epistasis’?
a. The movement of the spindle during eukaryotic cell division
b. The genetic effect of a single gene on multiple phenotypic traits
c. The action of one gene modifying the effects of other genes
d. The genetic exchange that takes place between homologous chromosomes during prophase I of meiotic cell division]
e. The microevolutionary process caused by random sampling of alleles
b. The genetic effect of a single gene on multiple phenotypic traits
The restriction enzyme EcoRI cuts DNA molecules at the following restriction site: 5’ GAATTC 3’
3’ CTTAAG 5’
How many double-stranded fragments will result if the following DNA molecule is cut with EcoRI?
5’ TTAACGATGCGAAGGATCCAACGTTTAGGCCGAAATTCCTGGAATTCAATTCTTACATCCCA 3’
3’ AATTGCTACGCTTCCTAGGTTGCAAATCCGGCTTTAAGGACCTTAAGTTAAGAATGTAGGGT 5’
a. Four
b. Three
c. Six
d. Five
e. Two
b. Three
Which of the following terms relates to the structure of double-stranded DNA?
a. Amino acid
b. Hydrogen bond
c. Protein
d. Peptide
e. Lipid
b. Hydrogen bond
Alan and Betty are both carriers (heterozygotes) for a recessive genetic disorder. If Alan and Betty have two children, what is the probability that only one of the two children will be affected by this genetic disorder?
a. 0.2500
b. 0.5000
c. 0.0625
d. 0.3750
e. 0.1875
a. 0.2500
Sickle cell anaemia (a recessive genetic disorder) affects approximately 1 in 130 people in Cameroon, a country in West Africa. Therefore, assuming Hardy Weinberg Equilibrium (HWE), which of the answers below represents the best estimate of the frequency of the mutant sickle cell allele in the Cameroonian population?
a. 0.176
b. 0.091
c. 0.088
d. 0.044
e. 0.008
c. 0.088
Q^2 = 1/130
Q = sq. root 1/130
Q = 0.0877
Sickle cell anaemia (a recessive genetic disorder) affects approximately 1 in 130 people in Cameroon, a country in West Africa. Therefore, assuming Hardy Weinberg Equilibrium (HWE), which of the answers below represents the best estimate of the frequency of the mutant sickle cell allele in the Cameroonian population?
a. 0.176
b. 0.091
c. 0.088
d. 0.044
e. 0.008
c. 0.088
Q^2 = 1/130
Q = sq. root 1/130
Q = 0.0877
The genetic distance between two genes is 7 centimorgans (cM). What is the expected recombination frequency between these two genes?
a. 0.07
b. 0.04
c. 0.70
d. 014
e. 0.35
a. 0.07
1 cM = 1%
7 cM = 7%
Which of the following will most dramatically change the amino acid sequence of a polypeptide?
a. The insertion of three nucleotides in the middle of a gene coding sequence
b. The deletion of three nucleotides in the middle of a gene coding sequence
c. A single nucleotide substitution in the middle of a gene coding sequence
d. The insertion of two nucleotides in the middle of a gene coding sequence
e. The deletion of six nucleotides in the middle of a gene coding sequence
b. The deletion of three nucleotides in the middle of a gene coding sequence
Who showed that the material in dead bacterial cells that can genetically transform living bacterial cells is actually DNA?
a. Rosalind Franklin
b. Fred Griffith
c. Oswald Avery, Colin MacLeod, and Maclyn McCarthy
d. Frederick Sanger and Linus Pauling
e. James Watson and Francis Crick
c.Oswald Avery, Colin MacLeod, and Maclyn McCarthy
A colour-blind man has children with a woman who is a carrier for this genetic trait. What are the expected offspring proportions from this mating?
a. 25% carrier female | 25% normal females | 25% colour-blind males | 25% normal males
b. 50% carrier females | 25% colour-blind males | 25% normal males
c. 25% colour-blind females | 25% carrier females | 50% colour-blind males
d. 50% normal females | 50% colour-blind males
e. 25% colour-blind females | 25% carrier females | 25% colour-blind males | 25% normal males
b. 50% carrier females | 25% colour-blind males | 25% normal males
What cellular process is shown in the electron micrograph below?
a. Protein synthesis
b. Hydrogen bonding between two strands of a double-stranded DNA molecule
c. Synapsis and recombination between homologous chromosomes during prophase I of meiotic cell division
d. Replication of deoxyribonucleic acid (DNA)
e. Transcription of ribonucleic acid (RNA)
c. Synapsis and recombination between homologous chromosomes during prophase I of meiotic cell division
The incidence of cystic fibrosis (a recessive genetic disorder) in Germany is approximately 1 in 3,300. Therefore, assuming Hardy-Weinberg Equilibrium (HWE), which of the answers below represents the best estimate of the frequency of the mutant cystic fibrosis allele in the German population?
a. 0.0222
b. 0.0174
c. 0.0003
d. 0.1421
e. 0.0051
b. 0.0174
The term endosymbiosis refers to which of the following biological phenomena?
a. A scientific theory for the origin of eukaryotic mitochondria and chloroplasts
b. Infection of bacterial cells by bacteriophage viruses
c. The reformation of the nuclear membrane in newly divided eukaryotic cells
d. The occurrence of mutations within the coding sequence of a gene
e. The tRNA-mediated transport of amino acids to ribosomes
a. A scientific theory for the origin of eukaryotic mitochondria and chloroplasts
144) There is a mutant allele in a gene that controls eye shape in Drosophila termed gl (wild type allele: gl+) that is located on Drosophila chromosome three. Flies homozygous for the mutant allele have small smooth egg-shaped eyes (‘glass eyes’). There is also a mutant allele in a gene that controls the number of hairs on the body of Drosophila flies termed h (wild type allele: h+). This gene is also located on Drosophila chromosome three. Flies homozygous for the mutant allele have much hairier bodies than normal flies. A cross is carried out as follows:
A number of doubly heterozygous females (gl+gl h+h) are crossed with doubly homozygous recessive males (gl gl h h) and the following offspring numbers are obtained:
gl+gl h+h Normal-eyes-normal-body: 486
gl gl h h Glass-eyes-hairy-body: 474
gl+gl h h Normal-eyes-hairy-body: 263
gl gl h+h Glass-eyes-normal-body: 277
What is the genetic distance in centimorgans (cM) between these two genes?
a. 50 cM
b. 36 cM
c. 18 cM
d. 54 cM
e. 24 cM
b. 36 cM
263 + 277 / 486 + 474 + 263 + 277
= 0.36 = 36 cM
The term ‘semi-conservative’ is used to refer to the mechanism governing which of the following molecular biological processes?
a. Transcription of RNA
b. Replication of DNA
c. Translation of RNA
d. Condensation of chromatin
e. Export of mRNA from the nucleus to the cytoplasm
b. Replication of DNA
Under the assumption of Hardy-Weinberg equilibrium (HWE), what would be the expected genotype frequencies for a gene with two alleles (‘A’ and ‘a’) where the frequency of the ‘A’ allele (p) is 0.70 and the frequency of the ‘a’ allele (q) is 0.30?
a. Frequency of the ‘AA’ genotype = 0.49
Frequency of the ‘aa’ genotype = 0.42
Frequency of the ‘Aa’ genotype = 0.09
b. Frequency of the ‘AA’ genotype = 0.09
Frequency of the ‘aa’ genotype = 0.49
Frequency of the ‘Aa’ genotype = 0.42
c. Frequency of the ‘AA’ genotype = 0.42
Frequency of the ‘aa’ genotype = 0.09
Frequency of the ‘Aa’ genotype = 0.49
d. Frequency of the ‘AA’ genotype = 0.70
Frequency of the ‘aa’ genotype = 0.30
Frequency of the ‘Aa’ genotype = 0.00
e. Frequency of the ‘AA’ genotype = 0.49
Frequency of the ‘aa’ genotype = 0.09
Frequency of the ‘Aa’ genotype = 0.42
e. Frequency of the ‘AA’ genotype = 0.49
Frequency of the ‘aa’ genotype = 0.09
Frequency of the ‘Aa’ genotype = 0.42
HWE = p2 + q2 + 2pq = 1
(0.7)2 = 0.49 AA
(0.3)2 = 0.09 aa
2(0.7)(0.3) = 0.42 Aa
