Richard Flashcards
A. Discovery of restriction enzymes (REs) conclusion?
Conclusion: Passage of virus
particles between bacterial strains
leads to a ‘restriction’ in titre
•Arber showed what about restriction and methylation
Arber showed that phage DNA from different hosts had
different methylation patterns (A, C methylated)
•Also showed that incoming DNA undergoes cleavage
if it is from a different strain
Hamilton Smith isolated an enzyme from E. coli
that cut DNA at specific nucleotide sequences
HYPOTHESIS:
that the restriction in phage titre is the result of a
“restriction enzyme” that cuts DNA at specific
recognition sequences
that different strains of E. coli have restriction
enzymes and methylation enzymes that
recognise different sequences
that host DNA is protected from cleavage by its
own restriction enzymes because it methylates
the same sequences
Why has restriction modifications occured? When do some infections occur and when do 10^12 infections occur?
Restriction modification systems
evolved as a defence against phage.
10^6 pfus / mL (ie) 1 in a million infectious
Incoming DNA unmethylated so no protection.
Most is cleaved by RE - a few escape by becoming
methylated de novo and start infection process.
1012 pfus / mL All infectious (ie) All methylated,
no DNA cleavage
Summary of r-m systems 1
- Enzyme activities were discovered from the ‘restriction’ of virus titre during infection between bacterial strains
- The recognition sites for DNA cleavage and methylation were sequence-specific and identical within strains
- Both REs and methylating enzymes were purified and characterised biochemically
Summary of r-m systems 2
- R-M systems evolved as bacterial defence system against bacteriophages
- Host MEs methylate cellular DNA (including phage) at specific sequences
- Host REs cleave DNA at specific sequences
- The recognition sequences of the REs and MEs are the same for any strain of E. coli
- Methylated DNA is protected from cleavage by its own RE
- During replication, hemi-methylated DNA is recognised and the new strand methylated
- Viral infection of a new strain leads to “race” between host restriction systems and host modification systems to recognise their sites. Only in very rare cases does methylation “win” and protect the incoming phage DNA so that it can replicate.
Gel electrophoresis is an essential tool for cloning
Different gel systems resolve different sized fragments. Which gel resolve which fragments?
•Acrylamide (1 bp - 1 kb, Sequencing, gels, ssDNA)
•Agarose ( 0.5 - 20 kb, plasmid, cloning)
•PFGE (pulsed field gel
electrophoresis, 50 kb - 10 Mb )
What are Different REs that cleave with different frequencies
Sau3A GATC (1/4)4 = 1/256 bp (4-cutter)
EcoRI GAATTC 1/4096 ~ 1/4 kb (6-cutter)
NotI GCGGCCGC 1/65 kb (8-cutter)
•Frequency of cleavage is changed if GC content of
organism is altered (eg) Malaria parasite is 80% AT
•Mammalian genomes are depleted for CG dinucleotide pairs (1/5 of expected)
Restriction maps can be constructed for any
DNA sequence. 1. Multiple RE digests
1. Multiple RE digests • Linear or circular? • Estimate total size • Estimate # cuts per RE • Use single cutter as anchor point • Identify differences in digests +/- anchor RE • Draw possible map and check
T4 DNA ligase can join ends of DNA together. How does this work?
•Enzyme purified from cells infected with from bacteriophage T4
•Reconnects phospho-diester bonds between nucleotides
•Only requirement is a free 3’-OH and a free 5’-PO4
•Blunt or annealed sticky ends are substrates
•Needs (ribose) ATP as energy source, Mg2+
as cofactor
Any EcoRI end can base pair with any other EcoRI end. How does this happen?
RE cleavage usually generates “sticky ends”
(ss complementary termini). Early cloning strategies use RE sticky ends for ligation. • Any restriction fragment can be cloned in any orientation
(for typical RE like EcoRI)
• Directional cloning can be achieved by using pairs of enzymes with different cohesive termini
• Ligase can also join blunt termini - gives even more flexibility since all termini can be made blunt by DNA Pol I.
how does Analysis of cloned fragments happen on agarose gels
DNA is stained with
ethidium bromide and
photographed under uv
light (302 nm)
Newer variations of cloning avoid
the use of ligase
• ligase activity of topoisomerase I (fast, efficient)
• site-specific recombinases
(eg lambda attachment site “Gateway” cloning)
• Long sticky ends: 20-40 bp overhanging ends anneal stably without ligase ligation in vivo
Methods to introduce plasmid DNA into bacteria
DNA transformation
- Chemical treatments: Ca2+, Rb2+, heat shock (1972 - 1980’s)
- Electroporation: Apply square pulse of current –> “pores” in wall/membrane (1980’s-90’s)
•Both methods approach 109
-1010 tfmts per mg of DNA in E. coli, with up to 10-25% of cells “competent” to receive DNA •Mechanism of uptake not fully understood
•Size limit for chemical procedure (frequency drops above 20 kb plasmids)
•Some bacteria naturally highly competent for
transformation (Bacillus subtilis - just add DNA)
What are the Most common plasmid vectors that
are based on ColE1. And What improvements were made to increase transfer of plasma vectors?
Improvements •Addition of good selectable marker (antibiotic resistance) •Mutations that increase copy number (DNA yield) 15 copies/cell for pMB1 30 copies/cell for pBR322 200 copies/cell for pUC •Addition of laca gives simple blue/white screen for inserts •Removal of unwanted RE sites •Addition of unique sites in Multiple Cloning Site (MCS aka polylinker) BIOSCI 202 Lecture 23 D. Transformation and plasmid vectors AAGCTTCTGCAGGTCGACTCGAGGGATCCCCGGGTACCGAGCTCGAATTC HindIII PstI SalI XhoI BamHI KpnI SphI EcoRI SmaI (MCS aka “polylinker”)
