quiz 4 deck Flashcards
List key characteristics of genetic material
Must contain complex information
must replicate faithfully
must encode the phenotype
must have the capacity to vary
Describe how several key experiments demonstrated that DNA was the genetic material.
Avery Macleod and mccarty’s experiment revealed the transforming principle to be DNA ; In a very simple experiment, Oswald Avery’s group showed that DNA was the “transforming principle.” When isolated from one strain of bacteria, DNA was able to transform another strain and confer characteristics onto that second strain. DNA was carrying hereditary information
Griffith experiment demonstrated transformation in bacteria; the transforming bacteria ; In this experiment, Griffith mixed the living non-virulent bacteria with a heat inactivated virulent form. He subsequently infected mice with this mixture and much to his surprise, the mice developed pneumonia and died. Furthermore, he was able to isolate colonies of the virulent strain from these mice.
Outline the primary and secondary structures of DNA.
The primary structure of dna is held together with phosphodiester bonds while the secondary structure is held with hydrogen bonds
Primary structure of DNA is the sequence of bases in a strand (for example: TAAAGGCCATTTTGGCGTTTGTC?.) Secondary structure of DNA is the interactions between bases that allow for the formation of more complex structures. DNA’s secondary structure tends to be a double helix.
Describe how nucleotides are joined together in a polynucleotide strand.
The nucleotides join together by means of a phosphodiester bond (Fig. 4.7). The phosphodiester bond links the phosphate group of one base to –OH group on the 3-carbon of the sugar of another base.
Explain the antiparallel and complementary characteristics of DNA
DNA is made up of two strands. Each strand has a backbone made up of alternating sugars and phosphate groups. The two strands are linked by complementary nitrogenous bases. The strands are oriented in opposite directions, making the structure “antiparallel”.
Antiparallel:
The antiparallel characteristic of DNA refers to the arrangement of the two strands of the DNA molecule in opposite directions. In other words, one strand runs in the 5’ to 3’ direction while the other strand runs in the 3’ to 5’ direction. This antiparallel arrangement is essential for the complementary base pairing between the nitrogenous bases of the two strands.
Complementary:
The complementary characteristic of DNA refers to the specific pairing of the nitrogenous bases on the two strands of the DNA molecule. Adenine (A) always pairs with thymine (T), and cytosine (C) always pairs with guanine (G). This base pairing is specific and complementary, meaning that the sequence of one strand determines the sequence of the other strand. This complementary base pairing allows DNA to be replicated accurately during cell division and also provides the basis for protein synthesis.
Describe the different secondary structures of DNA and what factors produce these differences
The double helix structure is the most stable and common form of DNA, where two complementary strands of DNA are wrapped around each other in a helical shape. The stability of the double helix structure is due to the hydrogen bonding between complementary nitrogenous base pairs (A-T and C-G) and the hydrophobic interactions between stacked base pairs.
The single-stranded hairpin loop structure occurs when a single strand of DNA folds back on itself, forming a hairpin-like structure. This structure is stabilized by hydrogen bonding between complementary nucleotides on the same strand. Hairpin loops are often involved in regulating gene expression and can also form during DNA replication and repair processes.
Factors that influence the secondary structure of DNA include the sequence of nucleotides, the presence of chemical modifications (such as methylation), and environmental factors such as temperature and pH. These factors can affect the stability of the hydrogen bonds and the hydrophobic interactions between base pairs, and can also influence the formation and stability of hairpin loops.
List some of the genetic implications of DNA structure
Replication: The complementary base pairing of the two strands of DNA allows for accurate replication of genetic information during cell division.
Mutations: Changes in the DNA structure can lead to mutations, which can result in altered genetic information and potentially lead to genetic disorders.
Gene expression: The secondary structure of DNA can affect the accessibility of genes to transcription factors, which can influence gene expression and ultimately determine cell fate and function.
Genetic variation: The sequence and structure of DNA can vary between individuals, contributing to genetic variation and diversity within a population.
Genetic engineering: Knowledge of the structure of DNA has allowed for the development of genetic engineering techniques, such as gene editing and gene therapy, which have the potential to treat genetic disorders and enhance human health.
Describe special structures that occur within DNA and RNA
DNA double helix: The double helix structure is the most common and stable form of DNA, in which two complementary strands of DNA are wrapped around each other in a helical shape.
RNA secondary structures: RNA molecules can form a variety of secondary structures, including hairpin loops, stem-loop structures, and pseudoknots. These structures are stabilized by complementary base pairing within the RNA molecule.
Telomeres: Telomeres are repetitive DNA sequences located at the ends of chromosomes that protect the genetic information from degradation during cell division.
Centromeres: Centromeres are regions of DNA that play a critical role in cell division, as they are responsible for the proper separation of chromosomes during mitosis and meiosis.
Ribosomes: Ribosomes are complex structures made up of RNA and protein that facilitate the translation of genetic information from mRNA into proteins.
Histones: Histones are proteins that package DNA into chromatin, helping to regulate gene expression by controlling the accessibility of genes to transcription factors.
Introns and exons: In eukaryotic DNA, genes are often composed of both coding regions (exons) and non-coding regions (introns). Introns are spliced out of the RNA transcript before it is translated into a protein, while exons are joined together to form the final mRNA molecule
Explain how large amounts of DNA are packed into a cell
Positive supercoiling occurs when the DNA helix is over-twisted, causing it to become more tightly coiled than the relaxed state. This form of supercoiling is commonly found in prokaryotic DNA, where it helps to compact the genome into a smaller space and allows for more efficient DNA replication and transcription. Positive supercoiling can also help to stabilize DNA by reducing the strain caused by torsional forces during transcription and DNA replication.
Negative supercoiling, on the other hand, occurs when the DNA helix is under-twisted, causing it to become more loosely coiled than the relaxed state. This form of supercoiling is commonly found in eukaryotic DNA, where it helps to open up the DNA double helix structure and facilitate DNA replication and transcription. Negative supercoiling also helps to relieve the torsional stress that accumulates during DNA replication and transcription
he first level of organization involves the winding of DNA around histone proteins to form nucleosomes. Nucleosomes are composed of a histone octamer (eight histone proteins) around which approximately 147 base pairs of DNA are wrapped. The DNA-histone complex is then coiled into a fiber-like structure called chromatin.
The second level of organization involves the folding of chromatin into loop domains, which are stabilized by proteins called scaffold proteins. These loops are further compacted into larger domains, which are arranged in a non-random manner to allow for specific gene expression patterns.
The final level of organization involves the formation of chromosomes during cell division. Chromosomes are composed of tightly compacted chromatin fibers that are further condensed into a highly compact structure visible under a microscope.
Describe how supercoiling is a consequence of over-rotating or under-rotating a DNA helix
Supercoiling is a consequence of over-rotating or under-rotating the DNA helix. Over-rotation of the DNA helix leads to positive supercoiling, which causes the DNA to become more tightly coiled than the relaxed state. This can occur during cellular processes such as DNA replication and transcription. Under-rotation of the DNA helix leads to negative supercoiling, which causes the DNA to become more loosely coiled than the relaxed state. Negative supercoiling is necessary for various cellular processes such as DNA replication and transcription. Supercoiling can have both positive and negative effects on DNA structure and function, depending on the specific context and extent of the supercoiling
List the different types of chromatin found in eukaryotic chromosomes.
Euchromatin: This is the less condensed, more transcriptionally active form of chromatin. Euchromatin is often found in regions of the genome that are actively transcribed, such as protein-coding genes. Euchromatin is composed of loosely packed nucleosomes and is more accessible to DNA-binding proteins such as transcription factors.
Heterochromatin: This is the highly condensed, less transcriptionally active form of chromatin. Heterochromatin is often found in regions of the genome that are not actively transcribed, such as centromeres and telomeres. Heterochromatin is composed of tightly packed nucleosomes and is less accessible to DNA-binding proteins.
There are also two subtypes of heterochromatin:
a) Constitutive heterochromatin: This is a type of heterochromatin that is always present and highly condensed in all cells of an organism. It typically contains highly repetitive DNA sequences that do not code for genes.
b) Facultative heterochromatin: This is a type of heterochromatin that can switch between the condensed and decondensed states depending on cellular needs. For example, during development, some genes may be silenced by being packaged into facultative heterochromatin until they are needed for specific functions.
Describe the nucleosome structure
A nucleosome is the structural unit of DNA packaging in eukaryotes. A nucleosome is basically DNA segments surrounded by histone protein octamers resembling a thread coiled around a spool. A nucleosome is the fundamental unit of chromatin.
The nucleosome is the fundamental subunit of chromatin. Each nucleosome is composed of a little less than two turns of DNA wrapped around a set of eight proteins called histones, which are known as a histone octamer.
Outline the higher order chromatin structure found within a chromosome.
30-nm fiber: The 10-nm fiber of nucleosomes can be further compacted into a 30-nm fiber through a process of chromatin fiber condensation. The 30-nm fiber is thought to involve further interactions between the histone H1 and linker DNA, as well as interactions between adjacent nucleosomes.
Chromosome territories: The 30-nm fiber is then organized into a higher order structure where each chromosome occupies a specific region of the nucleus called the chromosome territory. Within the chromosome territory, the chromatin is further organized into loops of varying sizes, which are thought to be anchored to a scaffold composed of non-histone proteins. The loop domains are thought to be involved in regulating gene expression and replication timing.
Discuss how chromatin structure changes over time
During development: Chromatin structure changes dramatically during embryonic development, as cells differentiate into different tissues and cell types. The chromatin of stem cells is generally more open and accessible, allowing for greater flexibility in gene expression. As cells differentiate, the chromatin structure becomes more compact and specialized, resulting in specific gene expression patterns.
In response to environmental cues: Chromatin structure can also change in response to environmental cues, such as exposure to stress or changes in nutrient availability. For example, some genes that are normally repressed may become activated in response to stress, requiring changes in chromatin structure to allow for increased gene expression.
During DNA replication: Chromatin structure also changes during DNA replication, as the nucleosomes must be disassembled and reassembled on the newly synthesized DNA strands. This process is tightly regulated to ensure proper replication and maintenance of chromatin structure.
During cell division: Chromatin structure changes during cell division, as the chromatin must be condensed and packaged into chromosomes to ensure proper segregation to daughter cells.
Describe the special features of centromeres and telomeres
Centromeres: Centromeres are specialized regions of chromosomes that are essential for proper segregation during cell division. They are characterized by a specific DNA sequence that serves as a binding site for proteins that attach to spindle fibers, which pull the chromosomes apart during cell division. The centromere also helps to organize the chromosome into a compact and functional structure, and defects in centromere structure or function can lead to chromosomal instability and genetic disorders.
Telomeres: Telomeres are repetitive DNA sequences found at the ends of linear chromosomes. They serve to protect the chromosome ends from degradation and fusion with other chromosomes. Telomeres shorten with each round of cell division, eventually leading to cellular senescence or apoptosis. Telomerase, an enzyme that adds telomere repeats to chromosome ends, is active in some cells, such as stem cells and cancer cells, but is generally inactive in most somatic cells.
Describe different types of sequences found in eukaryotic chromosomes.
* Describe the characteristics of unique sequence DNA, moderately repetitive DNA, and highly repetitive DNA
Moderately repetitive DNA: These are short sequences that are repeated 10-1000 times in the genome. They are generally dispersed throughout the genome. Highly repetitive DNA: These are very short DNA sequences(<100bp) which are organised as long tandem repeats.
Outline the endosymbiotic theory (chloro and mito vs DNA)
The endosymbiotic theory proposes that eukaryotic cells evolved from a symbiotic relationship between two different types of prokaryotic cells: a host cell and an engulfed cell. The engulfed cell eventually became a permanent component of the host cell, forming mitochondria or chloroplasts, and providing energy through aerobic respiration or photosynthesis. This theory is supported by various lines of evidence, including the similarities between mitochondria and bacteria, the presence of circular DNA in mitochondria and chloroplasts, and the observation that both organelles divide independently of the host cell.
Give characteristics of the mitochondrial genome
five basic functions of mitochondrial genes:
respiration and oxidative phosphorylation
translation
transcription
rna processing
import of proteins into mitochondira
viable cells, no variation
Describe patterns of evolution in mitochondrial DNA.
Variation in the size of mitochondrial genomes between species is due to differences in noncoding DNA Sequences,
genes for most proteins and enzymes are found in mitochondria and are encoded by nuclear DNA
Explain how Meselson and Stahl demonstrated that DNA replication in E. coli occurs in a semiconservative
fashion
The experiment done by Meselson and Stahl demonstrated that DNA replicated semi-conservatively, meaning that each strand in a DNA molecule serves as a template for synthesis of a new, complementary strand
The Meselson Stahl Experiment. A centrifuge was used to separate DNA molecules labeled with isotopes of different densities. This experiment revealed a pattern that supports the semiconservative model of DNA replication.
Messelson and Stahl’s experiment supported the semi-conservative mode of replication. The DNA was first replicated in 14N medium which produced a band of 14N and 15N hybrid DNA. This eliminated the conservative mode of replication.
Predict the results that Meselson and Stahl would have obtained if replication occurred by conservative or
dispersive replication.
If the dispersive model of DNA replication had been correct Meselson and stahl would have observed that DNA extracted from bacterial cells following a second round of DNA replication in 14 and would have been only of hybrid density and somewhat lighter than after one round of replication
Outline semiconservative replication by theta and linear replication
in semiconservative replication by theta, the double-stranded DNA molecule unwinds at a specific origin of replication, forming a “theta” structure with a replication fork at each end. The DNA strands separate, and each serves as a template for a new complementary strand to be synthesized, resulting in two identical daughter DNA molecules. (DNA IS CIRCULAR)
In linear replication, the double-stranded DNA molecule has linear ends, and replication occurs bidirectionally from multiple origins of replication along the length of the DNA molecule. The leading strand is synthesized continuously, while the lagging strand is synthesized in short Okazaki fragments that are later joined together. The result is also two identical daughter DNA molecules.
bidirectional: two replication forks present at the end of the replication bubble, the forks process outward from the bubble in both directions until they meet
Unidirectional: only one replication fork present
