PCR Flashcards
Describe the PCR?
Polymerase chain reaction:
PCR selectively amplifies a stretch of DNA from a larger piece of DNA
This is a cyclical process and the amount of product doubles every cycle - exponential amplification of the region of interest
1 cycle is 1-2 minutes
You need around 25-30 cycles to generate detectable PCR product
It is exponential and eventually plateaus due to the primers being used up
Requires a forward and reverse primer which delimit the region of interest
Forward primer - 3’ end on the non-coding strand
Reverse primer - 5’ end on the coding strand
What are the stages of PCR?
This takes place in a thermocycler
Needing: template DNA, forward/reverse primers, dNTPs, Taq DNA polymerase and buffer
Denaturation - melts DNA duplexes into individual strands - ssDNA
Annealing - allows primers to anneal with template and polymerase to bind
Extension - extension of primers along the template by polymerase
Temperature - 95, 55, 72
What should be considered with PCR?
Primer sequence should be long enough to anneal only with the ends of the region of interest
Too short = annealing with other regions of the template
Too long = hybridise at a slower rate and decrease efficiency of the PCR
The primers do not have to be perfectly complementary to the annealing site (but the 3’ end that the polymerase recognises should be perfect) – can use to introduce mutations
What is essential to work out for PCR?
Tm - Melting temperature
The temperature at which 50% of a molecule remains double stranded and 50% is single stranded
Melting temperature of the primer is essential for the optimum temperature for annealing
Too high = primers/templates remain dissociated
Too low = mismatched hybrid - incorrect base pairings
This depends on the GC/AT composition of the primer
A higher GC content = higher tm for the same length primer - due to the additional hydrogen bonds
What should a primer design include?
Specificity
High efficiency
There should be no primer-dimers (primers annealing to each other) this is a wasteful reaction so need to be aware of complementarity within the primers
How do we calculate Tm?
Rule of 2+4
A quick rule of thumb for primers (oligos 20-25 nt long)
Tm (°C) = (2 x A+T) + (4 X G+C)
e.g. GATTTGCCTCTCTCGAAATTGGC = 11G+C and 12A+T
Rule of thumb = (11x 4)+(2x12) = 68°C
However this is quite a high temperature so we’d likely drop it a couple of degrees as it is a similar temperature to the optimum extension temperature
What are the advantages of PCR?
DNA or RNA can be amplified
Normal PCR for DNA
RNA needs to be converted into cDNA via reverse transcriptase (RT)-PCR
Only low amounts of starting material is needed
Sensitive and quantitative detection systems are available (aka real-time PCR)
Multiple samples and targets can be analysed simultaneously in quantitative PCR
What is quantitative PCR (Q-PCR)?
A form of PCR that measures the amount of the amplified DNA product by monitoring fluorescence emitted during each cycle (in real-time) instead of at a fixed end-point
The fluorescent signal increases in direct proportion to the amount of PCR product in the reaction mixture - uses a fluorimeter in a 96-well plate
Many samples can be analysed at once
Gives a sensitive and specific way of quantifying the initial amount of template (provided that appropriate standards are used)
We can work back to know how much DNA was in the original sample
We are most interested in the early stages of this PCR
What are the kinetics of Q-PCR?
Plot PCR cycle number against ΔRn (normalized reporter value - fluorescent signal)
Ct Value is essential to know
What is the Ct Value?
The cycle at which the amount of PCR product crosses the threshold
Sometimes termed the threshold cycle
Sometimes called Cq ( the quantification cycle)
The machine sets a threshold based on a cycle with no template = no product
What are some applications of Q-PCR?
Quantification of infectious agents (HIV, HPV, SARS-Co-V2)
Analysis of gene expression at the mRNA level
Describe fluroescence in Q-PCR?
It is generated by fluorescent reporters, there are two types:
Intercalating dyes bind to dsDNA and form complexes that emit increased fluorescence
SYBR Green
This will bind to any double stranded DNA regardless of it’s sequence
Sequence specific probes - they bind to a specific double stranded piece of DNA
- Hydrolysis based probes (TaqMan) - fluorescence is emitted by hydrolysis of probes following their hybridization to the template DNA and primer extension
- Hybridisation based probes - fluorescence is vastly enhanced when probes are based paired with the template DNA, which changes their 3D structure
Depending on their mechanism of action they are classed as molecular beacons or FRET probes
Describe the hydrolysis sequence specific probe TaqMan?
It is very small
The probe contains a reporter and a quencher at either end
When the strand is displaced the small PCR fragments (<100 bp) bind to the reporter
Cleavage of the reporter molecule is mediated by 5ʹ exonuclease of Taq DNA polymerase
Once the reporter is released and away from the quencher it can fluoresce
What is reverse transcription PCR (RT)-PCR?
We have to copy mRNA into cDNA for PCR amplification
Carried out to quantitate differences in mRNA expression
Internal standards and control are needed to ensure it runs well
Total RNA is isolated and prepared
Use small amounts of mRNA from: tissue, primary cells and clinical samples
What are some properties of (RT)-PCR?
Highly sensitive
Can discriminate between closely related mRNAs
Technically simple
Difficult to get truly quantitative results using normal RT-PCR - due to ‘plateau effect’
