Lab Exam Flashcards
Why is it important to replicate an experiment?
To ensure accurate, repeatable results (not due to errors in procedure or other set of environmental conditions present)
Describe an egg in a solution with a high concentration of sucrose (reference tonicity, appearance)
Solution is hypertonic (higher concentration of sucrose in solution than in cell); membrane is permeable to water (and not sucrose), so water moves from low [sucrose] to high [sucrose] (i.e. moves from cell to outside); cell appears shriveled, smaller (loss of weight)
Describe an egg in a solution with a low concentration of sucrose (reference tonicity, appearance)
Solution is hypotonic (lower concentration of sucrose in solution than in cell); membrane is permeable to water (and not sucrose), so water moves from low [sucrose] to high [sucrose] (i.e. moves from outside to cell); cell appears bloated/larger (gain weight), may lyse (explode)
Describe an egg in a solution with a normal concentration of sucrose (reference tonicity, appearance)
Solution is isotonic (same concentration of sucrose in solution and in cell); no difference in [sucrose], so no net water movement (dynamic equilibrium, so water moves, but no NET movement) (minimal/no change in weight)
Is the membrane permeable to water?
Yes, we are assuming that the membrane is permeable to water, and thus is impermeable to the solutes; for mass to change, water is diffusing in/out of the egg (since membrane is impermeable to solutes), so must be permeable to water
Is the membrane permeable to sucrose?
No, cell wants to keep solutes within; therefore must be impermeable to sucrose
If permeable to sucrose, sucrose would be able to diffuse out of egg
The mass of an egg increased by an average of 1.30 g. Is the solution hypertonic, hypotonic, or isotonic?
The solution is hypotonic
- Mass increased
- Membrane only permeable to water, so water must enter cell
- Therefore lower concentration of solutes in solution (higher concentration of water)
- Water diffuses into cell, increases mass
The mass of an egg decreased by an average of 1.20 g. Is the solution hypertonic, hypotonic, or isotonic?
The solution is hypertonic
- Mass decreased
- Membrane only permeable to water, so water must leave cell
- Therefore higher concentration of solutes in solution (lower concentration of water)
- Water diffuses out of cell, decreases mass
The mass of an egg increased by an average of 0.01 g. Is the solution hypertonic, hypotonic, or isotonic?
The solution is isotonic
- Mass relatively the same
- Minimal change in mass=minimal water movement
- Therefore similar/same concentration of solutes in solution and cell
- Minimal/no water movement, minimal/no change in mass
What is a partition coefficient? How is it related to polarity?
Partition coefficient = Solubility in oil/Solubility in water;
- Value closer to 1 = high solubility in oil, low solubility in water
- Value close to 0 = low solubility in oil, high solubility in water
- Polar solvents dissolve polar solutes
- Water = polar –> high solubility in water = more polar (partition coefficient closer to 0)
- Oil = non-polar –> high solubility in oil = less polar (partition coefficient closer to 1)
Why does a solute’s solubility in oil affect its ability to cross the RBC membrane?
High solubility in oil = low polarity –> Low polarity = less attraction to polar molecules in solution (i.e. water), phosphate heads –> Crosses membrane faster
How do very polar molecules and strongly charged ions cross cell membranes?
Via membrane transport proteins –> Channels and Carriers
- Carriers typically have 2 shapes; 1 with solute, 1 without
- Channels allow specific solutes to pass through a “pore” the proteins forms on the membrane
Define independent and dependent variables
Independent –> Variable that is being manipulated
Dependent –> Variable being measured
How is it possible that two solutions with the same solute concentration have different results in terms of lysis time?
They have different permeabilities (i.e. the more permeable the membrane is to the solute, the faster the lysis, so different solutions = different permeabilities = different lysis times)
If the lysis time of solute X is twice as fast as that of solute D, what does it mean with regards to the permeability of the membrane to solute X and D?
The membrane is twice as permeable to solute X as to solute D because solute X (and the water that followed) was able to enter the cell twice as fast
Why does a solution of distilled water cause lysis faster than a solution of 0.3M ethylene glycol?
Because for lysis in the ethylene glycol solution, solute has to enter the cell, and then have water follow it (moving down its concentration gradient)
For distilled water, the water can directly enter the cell and thus cause lysis faster
What is the purpose of a negative control?
To ensure that a confounding variable (a complicating factor) doesn’t interfere with the results
Which strand of DNA is used to create the RNA strand?
The template strand (RNA is the same as the coding strand but with uracil instead of thymine)
Translate the following strand of DNA (the top is the template, bottom is coding):
3’ GCTGACTAGTACGATCGTTCGACTCTTCGGATT 5’
5’ CGACTGATCATGCTAGCAAGCTGAGAAGCCTAA 3’
5’ CGACUGAUCAUGCUAGCAAGCUGAGAAGCCUAA 3’
use template strand
Briefly summarize polymerase chain reaction (PCR) and DNA cloning using plasmids
PCR - A sequence of DNA is copied at an exponential rate through the use of DNA polymerase; template strands heated up to seperate them, primers attached to ends, DNA polymerase attaches to primers and creates copies
DNA cloning - DNA sequence is inserted into a plasmid (small, circular, double-stranded DNA molecule); plasmid placed in a vector (i.e. bacteria), bacteria replicate (and thus replicate the DNA)
Describe how restriction endonuclease enzymes and gel electrophoresis can be used as “DNA fingerprinting”
Produce DNA fragments by using restriction endonuclease enzymes; separate fragments by electrophoresis; use radioactively labelled probe to allow bonding to be visualized via exposure to x-ray film; compare DNA typing patterns to see if they match
Describe how to determine what protein is produced by a particular DNA sequence by using plasmids and bacteria.
1) Use restriction enzyme to cleave plasmid; insert DNA sequence and resistance gene (i.e. resistance to antibiotic)
2) Insert plasmid into bacteria, treat with antibiotic (so that only bacteria with resistance (and thus plasmid & DNA sequence) survive)
3) Allow bacteria to reproduce/produce protein
How many bonds do the following atoms have in a DNA molecule?
Phosphorus Nitrogen Carbon Oxygen Hydrogen
P = 3 (located in backbone) N = 3 (located in bases) C = 4 O = 2 H = 1
How is it possible to differentiate between a purine base and a pyrimidine base? Which ones are larger? What bases are in each category?
Purine = larger (2 rings); A,G Pyrimidine = smaller (1 ring), C,U,T
How is it possible to determine whether a base pair is C-G or A-T?
Number of H-bonds; 3 in C-G, 2 in A-T
Why don’t purine-purine or pyrimidine-pyrimidine pairs ever exist?
Not enough space (purine-purine) or too much space (pyrimidine-pyrimidine) –> alters double-helix shape (alters backbone shape)
Why doesn’t A ever pair with C or G with T, even though these pairs contain a purine and a pyrimidine?
Different number of hydrogen bonds, different location of bonding sites
Withing a single DNA strand, how are the individual nucleotides joined together?
Joined by phosphodiester bonds between PO4 and carbon
How are the two DNA strands joined together?
By H-bonds between the base pairs
Do the two ends of the DNA strands look exactly the same?
No, they look different because the two strands are anti-parallel (3’ end on one strand, 5’ end on the other)
Describe the steps that occur during transcription & mRNA processing.
Initiation - RNA polymerase, along with transcription factors bind to the promoter region of the DNA (includes the TATA box); binds to the template strand, creates transcription bubble (breaks H-bonds in DNA); moves to transcription start point and begins to add complementary bases
Elongation - RNA polymerase moves along template strand of DNA from 3’ to 5’; synthesizes mRNA strand from 5’ to 3’ with complementary base-pairing
Termination - RNA polymerase reaches termination sequence, falls of DNA strand & leaves pre-mRNA
mRNA processing - pre-mRNA undergoes RNA splicing (introns removed, exons joined together), 5’ cap added, poly-A tail added (creates mature RNA); leaves cell through nuclear membrane and enter cytoplasm
Describe the steps that occur during translation.
Initiation - Small ribosomal subunit attaches to mRNA (recognizes 5’ cap), reads along to start codon, large ribosomal subunit attaches; tRNA carrying amino acid attaches to ribosome according to complimentary anticodon (first tRNA always carries methionine), enters P site
Elongation - Ribosome continues to read codons on mRNA, attract tRNA with correct anticodon (carrying amino acid); new tRNA enters A site; methionine attached to new amino acid via peptide bond (creates polypeptide), ribosome moves up (tRNA’s move up one site A –> P –> E (exit)) & continues to add amino acids
Termination - Ribosome reads stop codon; when stop codon enters A site, release factors react and enter P site, ending formation of peptide bonds (creating finished polypeptide); ribosomal subunits fall off of mRNA
What functions do Na-EDTA and SDS serve when extracting DNA?
Na-EDTA inhibits the activity of DNase (enzyme that would normally destroy DNA when cells are broken open)
SDS beaks open nuclear membranes to release DNA into solution
Why does DNA precipitate out at the interphase between the water and ethanol?
Because DNA is soluble in water, but less soluble in ethanol
What makes sticky ends of DNA “sticky”?
Free bases attract complimentary sequences
What is recombinant DNA?
Bacterial DNA with inserted human DNA in it (i.e. DNA broken open and then reconstructed)
What are some other possible hypotheses that could be tested regarding the permeability of RBC membranes?
The more kinetic energy a molecule has, the faster it can cross a membrane
If temperature increases, then RBC membrane permeability will not change
Once you’ve isolated the protein (that is coded by the potential “hamster killer” allele), what is a theoretical experiment that could be performed to test the protein’s effects on human-hamster interactions
Double-blind trial –> One group receives protein, one group receives placebo (sugar pill); observe human-hamster interactions; if more hamster deaths in protein-receiving group, then protein is linked to hamster-killers
In reality, multiple sequences of both the human and bacterial DNA would be mixed together in recombinant DNA. Would all plasmids become recombinant plasmids?
No, not all plasmids would become recombinant, because not all combinations of the mixed DNA will be accepted (i.e. some human DNA will rejoin with human DNA, some bacteria DNA will rejoin with bacteria –> no guaranterr of human & bacteria DNA combining to form recombinant plasmid)
Why is reaction rate of enzymatic digestion of starch so low at 0°C?
The reaction rate is so low because there is a minimal amount of energy available in the system, so it is harder for the amylase to break down the starch
The reaction rate of enzymatic digestion of starch peaks at 37°C, with sharp drop offs on either side. What is a possible explanation for this?
The most probable explanation is that the enzyme is designed for optimal function at 37°C, so the reaction rate is highest at that temperature (optimal temperature). As the temperature changes, the enzyme (which is a protein) denatures and changes its shape, making it difficult to perform its intended function.
How would the graph of amylase from a human and from a bacteria that thrives in warm water around 70°C differ?
The graphs would have the same general shape, but the amylase from the bacteria would peak at 70°C, while the human graph would peak at 37°C
Succinic dehydrogenase turns succinic acid into fumaric acid and hydrogen atoms. When tested with methylene blue (changes from blue to colourless when reacting with hydrogen atoms), if a potential inhibitor is working, will the mixture be more blue or less blue?
The mixture will be a deeper blue, since the succinic dehydrogenase will not be able to convert succinic acid into fumaric acid and hydrogen atoms. The lack of hydrogen atoms means the methylene blue will not change colours (will remain a deep blue).
What is the function of having a control of only enzyme, only substrate, and only substrate and enzyme?
To establish a baseline for what to expect from just substrate, just enzyme and a normal reaction between the enzyme and the substrate.
If a chemical that was not an inhibitor was tested, would substrate concentration affect the results?
Yes, substrate concentration would affect the results, but only if an excess of enzyme was present (because then more substrate could react with enzyme). If an excess of enzyme was not present, then the substrate concentration would not matter (because there would be no more enzyme to react with)
How would an increased substrate concentration affect a reaction involving a competitive inhibitor?
Increasing the substrate concentration would make it more likely for the enzyme to react with the substrate (as opposed to the inhibitor) because there would be more substrate present than inhibitor.
How would an increased substrate concentration affect a reaction involving a non-competitive inhibitor?
Increasing the substrate concentration would have no effect on the results, as a non-competitive (or allosteric) inhibitor causes a conformational change in the active site, so the enzyme would be unable to bind to the substrate, regardless of the substrate concentration
Did the reaction rate increase with an increase in the concentration of enzyme?
Yes, reaction rate increased with an increase in enzyme concentration, because there was more enzyme present to react with the substrate. However, the reaction rate will eventually plateau due to the limiting factor of the concentration of substrate
When enzyme concentrations are constant, and substrate concentrations are increased, why does reaction rate initially increase before plateauing?
The increased substrate concentrations means that more substrate can react with the enzymes, until there is more substrate than enzyme, at which point the reaction rate plateaus because regardless of how much more substrate is added, there is no enzyme left to react with.
Amylase is produced by the body to help digest starch into simple sugars that can be absorbed. Is low blood sugar (due to a lack of sugar-uptake) more likely because of a lack of substrate (starch) or a lack of enzyme (amylase)?
This is most likely due to a lack of enzyme, as without the enzyme, the sugar cannot be absorbed (regardless of how much starch is present), as the starch must be broken down into simpler sugars in order to be absorbed
Why are reaction rates lower at non-optimal pH? (i.e. higher or lower pH than optimal)
Reaction rates lower as pH changes from the optimal pH because enzymes are proteins, and a change in pH results in a change in shape of the enzyme, meaning it is not able to bind to the active site as well, reducing the reaction rate.
Why might a broad pH tolerance benefit fungi, but not humans?
A broader pH tolerance would benefit fungi because the environments (e.g. soils) that they grow in can have a variety of different pHs, while the pH in the human digestive system is much more stable
