Lab Exam Flashcards
Why is it important to replicate an experiment?
To ensure accurate, repeatable results (not due to errors in procedure or other set of environmental conditions present)
Describe an egg in a solution with a high concentration of sucrose (reference tonicity, appearance)
Solution is hypertonic (higher concentration of sucrose in solution than in cell); membrane is permeable to water (and not sucrose), so water moves from low [sucrose] to high [sucrose] (i.e. moves from cell to outside); cell appears shriveled, smaller (loss of weight)
Describe an egg in a solution with a low concentration of sucrose (reference tonicity, appearance)
Solution is hypotonic (lower concentration of sucrose in solution than in cell); membrane is permeable to water (and not sucrose), so water moves from low [sucrose] to high [sucrose] (i.e. moves from outside to cell); cell appears bloated/larger (gain weight), may lyse (explode)
Describe an egg in a solution with a normal concentration of sucrose (reference tonicity, appearance)
Solution is isotonic (same concentration of sucrose in solution and in cell); no difference in [sucrose], so no net water movement (dynamic equilibrium, so water moves, but no NET movement) (minimal/no change in weight)
Is the membrane permeable to water?
Yes, we are assuming that the membrane is permeable to water, and thus is impermeable to the solutes; for mass to change, water is diffusing in/out of the egg (since membrane is impermeable to solutes), so must be permeable to water
Is the membrane permeable to sucrose?
No, cell wants to keep solutes within; therefore must be impermeable to sucrose
If permeable to sucrose, sucrose would be able to diffuse out of egg
The mass of an egg increased by an average of 1.30 g. Is the solution hypertonic, hypotonic, or isotonic?
The solution is hypotonic
- Mass increased
- Membrane only permeable to water, so water must enter cell
- Therefore lower concentration of solutes in solution (higher concentration of water)
- Water diffuses into cell, increases mass
The mass of an egg decreased by an average of 1.20 g. Is the solution hypertonic, hypotonic, or isotonic?
The solution is hypertonic
- Mass decreased
- Membrane only permeable to water, so water must leave cell
- Therefore higher concentration of solutes in solution (lower concentration of water)
- Water diffuses out of cell, decreases mass
The mass of an egg increased by an average of 0.01 g. Is the solution hypertonic, hypotonic, or isotonic?
The solution is isotonic
- Mass relatively the same
- Minimal change in mass=minimal water movement
- Therefore similar/same concentration of solutes in solution and cell
- Minimal/no water movement, minimal/no change in mass
What is a partition coefficient? How is it related to polarity?
Partition coefficient = Solubility in oil/Solubility in water;
- Value closer to 1 = high solubility in oil, low solubility in water
- Value close to 0 = low solubility in oil, high solubility in water
- Polar solvents dissolve polar solutes
- Water = polar –> high solubility in water = more polar (partition coefficient closer to 0)
- Oil = non-polar –> high solubility in oil = less polar (partition coefficient closer to 1)
Why does a solute’s solubility in oil affect its ability to cross the RBC membrane?
High solubility in oil = low polarity –> Low polarity = less attraction to polar molecules in solution (i.e. water), phosphate heads –> Crosses membrane faster
How do very polar molecules and strongly charged ions cross cell membranes?
Via membrane transport proteins –> Channels and Carriers
- Carriers typically have 2 shapes; 1 with solute, 1 without
- Channels allow specific solutes to pass through a “pore” the proteins forms on the membrane
Define independent and dependent variables
Independent –> Variable that is being manipulated
Dependent –> Variable being measured
How is it possible that two solutions with the same solute concentration have different results in terms of lysis time?
They have different permeabilities (i.e. the more permeable the membrane is to the solute, the faster the lysis, so different solutions = different permeabilities = different lysis times)
If the lysis time of solute X is twice as fast as that of solute D, what does it mean with regards to the permeability of the membrane to solute X and D?
The membrane is twice as permeable to solute X as to solute D because solute X (and the water that followed) was able to enter the cell twice as fast
Why does a solution of distilled water cause lysis faster than a solution of 0.3M ethylene glycol?
Because for lysis in the ethylene glycol solution, solute has to enter the cell, and then have water follow it (moving down its concentration gradient)
For distilled water, the water can directly enter the cell and thus cause lysis faster
What is the purpose of a negative control?
To ensure that a confounding variable (a complicating factor) doesn’t interfere with the results
Which strand of DNA is used to create the RNA strand?
The template strand (RNA is the same as the coding strand but with uracil instead of thymine)
Translate the following strand of DNA (the top is the template, bottom is coding):
3’ GCTGACTAGTACGATCGTTCGACTCTTCGGATT 5’
5’ CGACTGATCATGCTAGCAAGCTGAGAAGCCTAA 3’
5’ CGACUGAUCAUGCUAGCAAGCUGAGAAGCCUAA 3’
use template strand
Briefly summarize polymerase chain reaction (PCR) and DNA cloning using plasmids
PCR - A sequence of DNA is copied at an exponential rate through the use of DNA polymerase; template strands heated up to seperate them, primers attached to ends, DNA polymerase attaches to primers and creates copies
DNA cloning - DNA sequence is inserted into a plasmid (small, circular, double-stranded DNA molecule); plasmid placed in a vector (i.e. bacteria), bacteria replicate (and thus replicate the DNA)
Describe how restriction endonuclease enzymes and gel electrophoresis can be used as “DNA fingerprinting”
Produce DNA fragments by using restriction endonuclease enzymes; separate fragments by electrophoresis; use radioactively labelled probe to allow bonding to be visualized via exposure to x-ray film; compare DNA typing patterns to see if they match
Describe how to determine what protein is produced by a particular DNA sequence by using plasmids and bacteria.
1) Use restriction enzyme to cleave plasmid; insert DNA sequence and resistance gene (i.e. resistance to antibiotic)
2) Insert plasmid into bacteria, treat with antibiotic (so that only bacteria with resistance (and thus plasmid & DNA sequence) survive)
3) Allow bacteria to reproduce/produce protein
How many bonds do the following atoms have in a DNA molecule?
Phosphorus Nitrogen Carbon Oxygen Hydrogen
P = 3 (located in backbone) N = 3 (located in bases) C = 4 O = 2 H = 1
How is it possible to differentiate between a purine base and a pyrimidine base? Which ones are larger? What bases are in each category?
Purine = larger (2 rings); A,G Pyrimidine = smaller (1 ring), C,U,T
How is it possible to determine whether a base pair is C-G or A-T?
Number of H-bonds; 3 in C-G, 2 in A-T
Why don’t purine-purine or pyrimidine-pyrimidine pairs ever exist?
Not enough space (purine-purine) or too much space (pyrimidine-pyrimidine) –> alters double-helix shape (alters backbone shape)
Why doesn’t A ever pair with C or G with T, even though these pairs contain a purine and a pyrimidine?
Different number of hydrogen bonds, different location of bonding sites
Withing a single DNA strand, how are the individual nucleotides joined together?
Joined by phosphodiester bonds between PO4 and carbon
How are the two DNA strands joined together?
By H-bonds between the base pairs
Do the two ends of the DNA strands look exactly the same?
No, they look different because the two strands are anti-parallel (3’ end on one strand, 5’ end on the other)
Describe the steps that occur during transcription & mRNA processing.
Initiation - RNA polymerase, along with transcription factors bind to the promoter region of the DNA (includes the TATA box); binds to the template strand, creates transcription bubble (breaks H-bonds in DNA); moves to transcription start point and begins to add complementary bases
Elongation - RNA polymerase moves along template strand of DNA from 3’ to 5’; synthesizes mRNA strand from 5’ to 3’ with complementary base-pairing
Termination - RNA polymerase reaches termination sequence, falls of DNA strand & leaves pre-mRNA
mRNA processing - pre-mRNA undergoes RNA splicing (introns removed, exons joined together), 5’ cap added, poly-A tail added (creates mature RNA); leaves cell through nuclear membrane and enter cytoplasm
Describe the steps that occur during translation.
Initiation - Small ribosomal subunit attaches to mRNA (recognizes 5’ cap), reads along to start codon, large ribosomal subunit attaches; tRNA carrying amino acid attaches to ribosome according to complimentary anticodon (first tRNA always carries methionine), enters P site
Elongation - Ribosome continues to read codons on mRNA, attract tRNA with correct anticodon (carrying amino acid); new tRNA enters A site; methionine attached to new amino acid via peptide bond (creates polypeptide), ribosome moves up (tRNA’s move up one site A –> P –> E (exit)) & continues to add amino acids
Termination - Ribosome reads stop codon; when stop codon enters A site, release factors react and enter P site, ending formation of peptide bonds (creating finished polypeptide); ribosomal subunits fall off of mRNA
What functions do Na-EDTA and SDS serve when extracting DNA?
Na-EDTA inhibits the activity of DNase (enzyme that would normally destroy DNA when cells are broken open)
SDS beaks open nuclear membranes to release DNA into solution
Why does DNA precipitate out at the interphase between the water and ethanol?
Because DNA is soluble in water, but less soluble in ethanol
What makes sticky ends of DNA “sticky”?
Free bases attract complimentary sequences
What is recombinant DNA?
Bacterial DNA with inserted human DNA in it (i.e. DNA broken open and then reconstructed)
What are some other possible hypotheses that could be tested regarding the permeability of RBC membranes?
The more kinetic energy a molecule has, the faster it can cross a membrane
If temperature increases, then RBC membrane permeability will not change
Once you’ve isolated the protein (that is coded by the potential “hamster killer” allele), what is a theoretical experiment that could be performed to test the protein’s effects on human-hamster interactions
Double-blind trial –> One group receives protein, one group receives placebo (sugar pill); observe human-hamster interactions; if more hamster deaths in protein-receiving group, then protein is linked to hamster-killers
In reality, multiple sequences of both the human and bacterial DNA would be mixed together in recombinant DNA. Would all plasmids become recombinant plasmids?
No, not all plasmids would become recombinant, because not all combinations of the mixed DNA will be accepted (i.e. some human DNA will rejoin with human DNA, some bacteria DNA will rejoin with bacteria –> no guaranterr of human & bacteria DNA combining to form recombinant plasmid)
Why is reaction rate of enzymatic digestion of starch so low at 0°C?
The reaction rate is so low because there is a minimal amount of energy available in the system, so it is harder for the amylase to break down the starch
The reaction rate of enzymatic digestion of starch peaks at 37°C, with sharp drop offs on either side. What is a possible explanation for this?
The most probable explanation is that the enzyme is designed for optimal function at 37°C, so the reaction rate is highest at that temperature (optimal temperature). As the temperature changes, the enzyme (which is a protein) denatures and changes its shape, making it difficult to perform its intended function.
How would the graph of amylase from a human and from a bacteria that thrives in warm water around 70°C differ?
The graphs would have the same general shape, but the amylase from the bacteria would peak at 70°C, while the human graph would peak at 37°C
Succinic dehydrogenase turns succinic acid into fumaric acid and hydrogen atoms. When tested with methylene blue (changes from blue to colourless when reacting with hydrogen atoms), if a potential inhibitor is working, will the mixture be more blue or less blue?
The mixture will be a deeper blue, since the succinic dehydrogenase will not be able to convert succinic acid into fumaric acid and hydrogen atoms. The lack of hydrogen atoms means the methylene blue will not change colours (will remain a deep blue).
What is the function of having a control of only enzyme, only substrate, and only substrate and enzyme?
To establish a baseline for what to expect from just substrate, just enzyme and a normal reaction between the enzyme and the substrate.
If a chemical that was not an inhibitor was tested, would substrate concentration affect the results?
Yes, substrate concentration would affect the results, but only if an excess of enzyme was present (because then more substrate could react with enzyme). If an excess of enzyme was not present, then the substrate concentration would not matter (because there would be no more enzyme to react with)
How would an increased substrate concentration affect a reaction involving a competitive inhibitor?
Increasing the substrate concentration would make it more likely for the enzyme to react with the substrate (as opposed to the inhibitor) because there would be more substrate present than inhibitor.
How would an increased substrate concentration affect a reaction involving a non-competitive inhibitor?
Increasing the substrate concentration would have no effect on the results, as a non-competitive (or allosteric) inhibitor causes a conformational change in the active site, so the enzyme would be unable to bind to the substrate, regardless of the substrate concentration
Did the reaction rate increase with an increase in the concentration of enzyme?
Yes, reaction rate increased with an increase in enzyme concentration, because there was more enzyme present to react with the substrate. However, the reaction rate will eventually plateau due to the limiting factor of the concentration of substrate
When enzyme concentrations are constant, and substrate concentrations are increased, why does reaction rate initially increase before plateauing?
The increased substrate concentrations means that more substrate can react with the enzymes, until there is more substrate than enzyme, at which point the reaction rate plateaus because regardless of how much more substrate is added, there is no enzyme left to react with.
Amylase is produced by the body to help digest starch into simple sugars that can be absorbed. Is low blood sugar (due to a lack of sugar-uptake) more likely because of a lack of substrate (starch) or a lack of enzyme (amylase)?
This is most likely due to a lack of enzyme, as without the enzyme, the sugar cannot be absorbed (regardless of how much starch is present), as the starch must be broken down into simpler sugars in order to be absorbed
Why are reaction rates lower at non-optimal pH? (i.e. higher or lower pH than optimal)
Reaction rates lower as pH changes from the optimal pH because enzymes are proteins, and a change in pH results in a change in shape of the enzyme, meaning it is not able to bind to the active site as well, reducing the reaction rate.
Why might a broad pH tolerance benefit fungi, but not humans?
A broader pH tolerance would benefit fungi because the environments (e.g. soils) that they grow in can have a variety of different pHs, while the pH in the human digestive system is much more stable
How does a chemical that is not an inhibitor affect the reaction? What about a competitive inhibitor? A non-competitive inhibitor?
A chemical that is not an inhibitor has minimal/no effect on the reaction (would slightly reduce reaction rate because overall concentrations would decrease)
A competitive inhibitor would reduce the rate of reaction (but the reaction would still occur to some extent –> some enzyme still binds to substrate)
A non-competitive inhibitor would prevent the reaction from occurring at all (change in shape = no binding to active site)
List, in order, the organs through which food passes through, and briefly summarize their functions
Mouth –> receives food; forms a bolus (mechanical digestion), helps break down starch
Esophagus –> Connects mouth & stomach; moves food via peristalsis
Stomach –> Temporarily stores food; some mechanical digestion and chemical digestion of protein occurs
Small intestine –> Where absorption occurs; completes chemical digestion of protein, carbohydrates, lipids
Cecum –> Connects small intestine (ileum) to large intestine; stores food for bacteria to break down cellulose in herbivores
Large intestine –> Reabsorbs water from indigestible food matter; absorbs some vitamins
Rectum –> stores feces until they can be expelled
Anus –> Opening at the end of rectum; controls expulsion of waste matter
List all the accessory organs to the digestive system, and briefly summarize their functions
Pancreas –> Secretes pancreatic juices (contains amylase, trypsin, lipase, nuclease & sodium bicarbonate) to help break down macromolecules and neutralize acidic chyme; secretes insulin/glucagon
Liver –> Produces biles, urea; helps detoxify blood (e.g. removes alcohol); destroys old red blood cells
Salivary glands –> Produces saliva (includes water, mucus, amylase); converts starch into maltose
Gallbladder –> Produces bile
Describe the three main tubes connected to the kidney in terms of what it carries, where it comes from, and where it ends up
Renal artery –> oxygenated blood; heart –> kidney
Renal vein –> deoxygenated blood; kidneys –> heart
Ureter –> urine; kidney –> bladder/urethra
How does the excretory system help maintain homeostasis when you are dehydrated?
When you are dehydrated, the body reabsorbs more water –> produce less urine (volume), but more concentration –> darker urine
What happens to all the fluid that enters the nephron as glomerular filtrate but is not part of the urine produced?
It is not filtered out and returns to the blood stream (at the renal vein)
How do humans replace the 1.5 L of fluid that we lose every day in the form of urine?
Through drinking water/other drinks; reabsorb water from food during digestion (in the large intestine)
Why is there no protein in the glomerular filtrate or urine?
Because proteins are large molecules, and cannot fit through the capillary walls, and therefore cannot make it into the glomerular filtrate or urine
Why is glucose present in the blood entering/exiting the glomerulus and in the glomerular filtrate, but not present in urine?
Glucose is reabsorbed from the filtrate, and thus is not present in the urine
Why are urea concentrations so much higher in urine than in the blood entering/exiting the glomerulus and glomerular filtrate?
To conserve energy, the body creates highly concentrated waste in as small a volume as possible (most urea in smallest volume of urine possible, so high [urea] in urine)
What are the enzymes involved in the digestion of starch? Where are they produced/active?
Salivary amylase –> Produced & active in mouth
Pancreatic amylase –> Produced in pancreas; active in small intestine
Maltase –> Produced & active in small intestine
What are the enzymes involved in the digestion of protein? Where are they produced/active?
Pepsin –> Produced in gastric glands; active in stomach
Trypsin –> Produced in pancreas; active in small intestine
Peptidases –> Produces & active in small intestine
What are the enzymes involved in the digestion of nucleic acids? Where are they produced/active?
Nuclease –> Produced in pancreas; active in small intestine
Nucleosidase –> Produced & active in small intestine
What are the enzymes involved in the digestion of fats? Where are they produced/active?
Lipase –> Produced in pancreas; active in small intestine
Why is more than one enzyme necessary for digesting most types of biological molecules?
- The body cannot absorb macromolecules, so most biological molcules must be broken down into smaller, less complex molecules for absorption
- Each enzyme is specific to breaking down one type of material, so for each material, a different enzyme is needed
What rgion of the kidney filters blood to form filtrate?
The glomerulus
What region of the kidney has high osmolarity (high concentration of solutes) that draws water out of the nephron through osmosis? What two solutes primarily cause this?
The loop of Henle (descending limb); caused by Na+, Cl-
What are the microscopic tubes that “collect” urine from nephrons and deliver the urine to the renal pelvis called?
Collecting ducts
What determines which solutes pass from the glomerulus into the Bowman’s capsule (and thus filtrate)?
The size of the molecules; large = stuck
small = pass through
What are some solutes that can pass from the blood into the filtrate (in the Bowman’s capsule)? What components of blood remain in the glomerulus?
Na+, Cl-, urea, glucose, water pass through
Protein, fats cannot pass through
ADH controls the reabsorption of water by aquaporins. Does ADH increase or decrease water reabsorption?
ADH increases water reabsorption
In what sections of the nephron is water reabsorbed?
Proximal convoluted tubule, descending arm (of the loop of Henle), distal convoluted tubule, collecting duct
What are the main solutes that contribute to the osmolarity (concentration –> #of solute particles/volume of fluid) of the interstitial fluid?
Na+, Cl-, urea
In what sections of the nephron is NaCl reabsorbed?
Ascending arm, distal convoluted tubule
When water, NaCl, and other solutes are reabsorbed from the filtrate, where do they go?
The reabsorbed elements diffuse into the capillaries, and flow into the renal vein (i.e. are returned to the bloodstream)
Why do kidneys go through such a complex process rather than just pump the unwanted molecules directly out of the blood?
- Directly removing the unwanted molecules requires a lot of active transport –> too much energy required
- Some toxins cannot diffuse across membranes (need transporters; too many toxins for specific transporters)
What effect does bile salts have on the speed with which fats are digested? Why does this occur?
Bile salts sped up the rate at which fats are digested; bile salts are an emulsifier (break fat molecules up into smaller droplets, increasing the SA, so the reaction occurs faster)
People suffering from gallstones sometimes have their gall bladders removed. Should these people stop eating fats completely?
No, they should not stop eating fats completely, because the body needs some fats to remain healthy. Additionally, lipase will still be produced, so fats can still be broken down, however the reaction will occur slower without bile salts. Because of this, these people should reduce their intake of fats, but not stop eating them completely.
How do the partial pressures of O2 and CO2 in blood change from when it enters the tissue capillaries to when it exits the tissue capillaries?
P(O2) decreases across the tissue capillaries (100 in, 0-40 in tissues, 40 out) because it is desired to move oxygen into the cell, so entering the P(O2) is high, but because O2 diffuses into the cell (along its PO2 gradient), the P(O2) out is lower.
The inverse is true of CO2 (want to remove from cell; so higher in cell than coming from arteries) –> (41 in, 60 in tissues, 47 out)
How do we maintain such a large partial pressure gradient of O2 in our alveoli?
We maintain such a high partial pressure gradient by constantly breathing (exhaling Co2, inhaling O2) -> inhaled O2 replaces O2 that has diffused into blood
When exercising strenuously, muscles consume more O2. What are some physiological responses to increase oxygen delivery?
Increased breathing rate –> higher intake of O2 –> more O2 in blood –> more O2 reaches muscles
Deeper breathing –> higher intake of O2 –> more O2 in blood –> more O2 reaches muscles
Increased heart rate –> blood circulates faster –> more O2 brought to muscles (more often)
What is the path of a red blood cell leaving the systemic capillaries?
Systemic capillaries –> venule –> vein –> vena cava –> right atrium –> tricuspid valve –> right ventricle –> pulmonary valve –> pulmonary artery –> pulmonary arterioles –> pulmonary capillaries –> pulmonary venules –> pulmonary vein –> left atrium –> mitral (bicuspid valve) –> left ventricle –> aortic valve –> aorta –> artery –> arteriole –> systemic capillaries
What causes the arteries to “pulse” (expand)?
The waves of blood pushed through the arteries each time the heart pump cause the artery to expand (and then contract) to keep the blood moving. The sudden expansion and contraction causes the artery to “pulse”
Why is there no “pulse” in the veins??
There is no pulse in the veins because veins have lower blood pressure, and do not have the muscular walls that arteries do, so they cannot expand and contract to create a “pulse”. Instead, the veins rely upon valves, gravity and the contraction of muscles surrounding the veins to pump blood back to the heart
What happens to the appearance of veins as they are raised to the height of the heart?
The veins become less prominent because when they are below the heart, they are unable to overcome gravity (not enough pressure), so the blood builds up in the veins causing them to expand and protrude. As the vein approached the height of the heart, it is able to push the blood back to the heart
Why do veins have one-way valves?
To prevent the backflow of blood due to low pressure in the vein when surrounding muscles are relaxed (not helping pushing blood back to the heart)
Why is it suggested to stretch and wiggle your toes on long airplane flights?
The movement (contractions) of the muscles helps push blood back to the heart, preventing a build of blood in the veins (a clot)
List the components of the respiratory system, and what they are attached to
Trachea –> Larynx, Bronchi
Lungs –> Trachea
Diaphragm –> Intercostals/rib/lungs
How does the diaphragm help us breathe?
When it contracts, it pulls down, causing the lungs to expand –> pressure in lungs decreases, air rushes in
What are the structural components that an oxygen molecule passes through as it travels from the nostril into the blood?
Nostril –> Nasopharynx –> Pharynx –> Larynx –> Trachea –> Bronchus –> Bronchiole –> Alveoli –> diffuses into capillary
Why are modern lungs more efficient at gas exchange than an ancestral balloon-like air bladder?
A modern lung contains many alveoli, which have thin membranes, decreasing diffusion distance, as well as increasing surface area, allowing oxygen to diffuse in faster
Why do birds have a different (and more efficient) respiratory system than mammals?
Birds have a one way flow through their respiratory system so that fresh air constantly flows through (maintaining a high gradient of P(O2)) in order to sustain the high metabolic rates that occur when they fly
What characteristics (physical and behavioural) might affect a person’s vital capacity?
Gender, height, genetics –> Physical
Exercise (training), health (e.g. smoking, drinking, drugs) –> Behavioural
Define the following: Vital capacity Tidal volume Expiratory reserve volume Inspiratory reserve volume
Vital capacity - the maximum amount of air that can be expelled in one breath
Tidal volume - the amount of air inspired or expired during normal breathing (can change depending on level of activity; at rest/relaxed = resting tidal volume)
Expiratory reserve volume - maximum amount of air that can be expelled after normal tidal expiration
Inspiratory reserve volume - maximum amount of air than can be inspired after normal tidal inspiration
Vital capacity = Tidal volume + expiratory reserve volume + inspiratory reserve volume
Why do we have a residual volume (some leftover air in the lungs)? How does it affect the efficiency with which oxygen can be brought into the bloodstream?
Residual volume prevents the lungs from collapsing (and the inside surfaces from sticking to each other, creating friction, making it hard to reinflate)
The residual volume slightly decreases the efficiency of oxygen intake (reduces the magnitude of the P(O2) gradient, so the oxygen diffuses from the atmosphere into the lungs slightly slower
Which side of the heart has more muscular ventricle walls?
The left ventricle has more muscular walls because it has to pump blood throughout the entire body, whereas the right ventricle only has to pump blood to the lungs
Describe the four stages of the cardiac cycle.
1) Atria contract (in systole); ventricles relaxed (in diastole); blood flows from atria into ventricles (atrioventricular valves are open to allow blood flow); semilunar valves are closed
2) Atria relax (diastole), ventricles begin to contract (systole); semilunar valves are still closed; atrioventricular valves are closed to prevent backflow of blood (from ventricles to arteries)
3) Atria remain relaxed (diastole), ventricles contract (systole); blood pumped into aorta & pulmonary vein (semilunar valves open); atrioventricular valves are closed
4) Atria and ventricles are relaxed (diastole); blood flows from veins into atria/ventricles; semilunar valves closed to prevent backflow from aorta/pulmonary artery; atrioventricular valves open
What are the structural differences between arteries and veins? Why do they occur?
Arteries have thicker walls, rounder/more “regular” shape because they contain muscular walls which contract/expand to help pump blood; veins rely on surrounding muscle contractions to pump blood; have valves to prevent backflow when muscles relax
Why is blood pressure normally measured in the brachial artery and not the brachial vein?
Because the artery has higher blood pressure (easier to sense), and is more stable, as blood pressure in the brachial vein depends on the elevation of the arm, the contraction of the muscle, and other factors, whereas the brachial artery has a somewhat constant pressure determined by the rate of blood flow from the heart.
What occurs in the sarcomeres during a muscular contraction?
- Actin & myosin lie side by side during relaxation
- Actin pulled towards centre of myosin filaments during contraction; sarcomeres shorten
- In full contraction, ends of actin myofilaments overlap, resulting in increased thickness of muscle
What are the three types of muscle tissuess? What are some visually defining features of each type of muscle tissue?
Skeletal, smooth, and cardiac muscle
Skeletal –> each fibre is one long cell with several nuclei & mitochondria; have a pattern of banding due to regular arrangement of (thick) myosin and (thin) actin myofilaments
Smooth –> cells are spindle-shaped; lack banded pattern of skeletal muscle cells; one nucleus/cell
Cardiac –> Have banded appearance like skeletal muscle cells, but are short and may be branched; cells contain intercalated discs (appear as dark lines)
What adaptations do the skeletal muscle cells in the bicep have for performing its function (moving the arm)?
Longer cells; multiple nuclei & mitochondria (higher power output)
What adaptations do the cardiac muscles in the heart have for the synchronized contraction needed for efficient pumping of blood?
Intercalated discs to communicate via electrical synapses –> faster communication
Why does ventricular fibrillation (electrical signal cycling uncontrollably) only occur in the heart? How does a high-voltage shock with a defibrillator restore normal cardiac function?
Only cardiac muscle cells communicate via electrical signals, so only cardiac muscle can be affected by ventricular fibrillation.
A high-voltage shock resets the system, allowing the heart to contract and pump normally.
Is ATP needed for muscle contraction?
Yes; without ATP, muscle fibres do not contract (shrink)
How does osmotic balance affect muscle contraction?
In the presence of ATP, ideal osmotic balance allows the muscle to contract more.
Without ATP, ideal osmotic balance has no effect on muscle contraction
Why is it important for athletes to balance the water and salts they gain/lose during strenuous exercise?
Athletes need to balance water/salt levels during strenuous exercise to ensure that ideal osmotic balance is present to allow for optimal muscle function (muscle contraction)
Paper is polar, and the chromatography solvent is non-polar. If pigment X has an Rf value of 0.35, and pigment Y has an Rf value of 0.75, which pigment is more polar?
Pigment X, because it has a lower Rf value. A higher Rf value indicates a less-polar substance, because it is more attracted to the solvent (and wants to follow it) than it is to the polar paper (where it would want to stay where it is).
What components are unique to neurons?
Soma, dendrites, axons, nodes of Ranvier, schwann cells,axon hillock, synapse, glial cells, myelin sheath
Where does the neuron receive information from other neurons?
Neurons receive information at the dendrites
Where is an action potential initiated on a neuron? What direction does the nerve impulse travel in?
At the axon hillock; travels down the axon, away from the soma
What structural feature does the neuron have for making the conduction of nerve impulses more efficient?
Myelin sheath; allows signals to travel much faster along neurons
Where does the neuron pass information on to other neurons?
At the synaptic cleft
How does the Na+/K+ pump create chemical gradients?
Pumps 3 Na+ out, 2 K+ in; makes inside of the cell more negative
As K+ diffuses out down its concentration gradients, what happens to the electrical gradient? How does the electrical gradient affect the diffusion of K+ out of the cell?
The outside of the neuron becomes positive, the inside becomes negative; outside of the cell is more positive, so slows down the diffusion of K+ out
Both chemical and electrical gradients cause Na+ to diffuse across the membrane of a neuron. Which direction does it diffuse?
Na+ diffuses into the cell
In terms of membrane potential (in mV), describe an action potential
- Resting potential –> (-70 mV)
- Stimulus (Na+ channels open, Na+ diffuses in) –> at (-55 mV) reaches threshold, depolarization triggered
- Depolarization –> voltage gated Na+ channels open, Na+ enters neuron; membrane potential rises to (+30 mV)
- Repolarization –> voltage-gated Na+ channels close, voltage-gated K+ channels open, K+ leaves neuron; membrane potential decreases to (-70 mV)
- Hyperpolarization –> K+ channels stay open longer than Na+ channels, more K+ out and Na+ in, so membrane potential drops below resting potential
- Resting potential –> cell returns to resting potential (-70 mV)
Why do plant leaves have 4 different pigments instead of just one?
Plant leaves contain 4 different pigments in order to absorb as much light as possible for photosynthesis
If a pigment solution appears green, are the green wavelengths of light being absorbed or transmitted? How can absorbance be used to alter plant growth rate?
Green wavelengths are being transmitted (not absorbed); Use high absorbance (e.g. violet light) to allow plant to grow faster; use low absorbance (green light) to keep plant growing as slowly as possible
What are some visual feature that can be used to differentiate between roots and stems? Monocots and dicots?
Roots –> adradial arrangement of phloem & xylem (not on same radius), endodermis present with Casparian strips
Stems –> perradial arrangement of xylem and plhoem (on same radius), no endodermis and Casparian strips
Monocot root –> Large vascular cylinder & centrla pith, xylem not in shape of cross
Dicot root –> Small vascular cylinder without central pith, xylem in shape of a cross
Monocot stem –> Random distribution of vascular bundles, no vascular cambium
Dicot stem –> vascular bundles in a circle around central pith, cambium present between xylem and phloem
What are some feature that can be used to differentiate between monocot and dicot leaves? Roots? Flowers? Seeds?
Leaves –> Monocot –> parallel veins
–> Dicot –> branching veins
Roots –> Monocot –> fibrous, branching roots
–> Dicot –> one main root (taproot), smaller roots branching off
Flowers –> Monocot –> Petals in multiples of 3
–> Dicot –> Petals in a multiple of 4 or 5
Seed –> Monocot –> One cotyledon
–> Dicot –> Two cotyledons
Describe the structure and function of the following leaf tissues: Epidermis Guard cells Xylem vessels Sieve-tube elements (phloem) Spongy mesophyll Sclerenchyma fibers
Epidermis –> single layer of tighly packed cells on upper & lower surface of leaf; living; thin cell walls –> protect from environment, secrete waxy cuticle
Guard cells –> Paired cells with a gap between them to form stomata; living; thicker inner walls than outer walls –> regulate opening/closing of stomata (regulate diffusion of CO2 in, O2 out), regulate water levels
Xylem vessels –> long cells with lignified cell walls, perforations at end openings; dead cells; thick cell walls –> conduct water upwards (roots –> shoot)
Sieve-tube elements (phloem) –> Elongated cells in phloem of flowering plants; living; thick cell walls –> transport carbohydrates throughout plant
Spongy mesophyll –> branched cells with large intercellular air spaces between them; living cells –> allow for the interchange of gasses for photosynthesis
Sclerenchyma fibers –> long, slender cells, normally in bundles or strands; dead cells; thick, lignified cell walls –> provide support for the cell
Why are more stomata closed after leaves have been left in the dark for 36 hours?
No light –> no photosynthesis –> no need for CO2 –> stomata close
No light –> no photosynthesis –> reduce water loss –> stomata close
What parts of a flower are present in a mature apple fruit?
Fruits are the ripened ovary and seeds of a flower
Describe the differences in leaf orientation and structure between a monocot and dicot leaf.
Monocot –> long, narrow and vertical leaf; parallel veins
Dicot –> horizontal, flatter, broader leaves; branched veins
Compare the location of stomata and the type/arrangement of mesophyll in monocot and eudicot leaves
Monocot –> equal distribution of stomata; only spongy parenchyma present (small intercellular spaces)
Dicot –> stomata only present on bottom of leaf; spongy& palisade parenchyma present (larger intercellular spaces)
How are the structural features of eudicot leaves optimized for photosynthesis while minimizing water loss?
- Fewer stomata (only on one side) to minimize water loss
- Leaves grow horizontally so water gathers on bottom of leaves
- Mesophyll is found between the upper and lower epidermis to aid in gas exchange and photosynthesis
How are water lilies different from typical eudicot leaves?
Stomata in the upper epidermis only (because otherwise would be pressed up against water, and unable to absorb CO2)
-Wide, flat leaves to distribute weight (to allow it to float)
Why do water lilies often have less xylem tissue than other eudicot leaves?
Always in contact with water (no need for water transport); reduced root system (primarily for anchorage, not absorption), so no need for transport of solutes/water from roots to leaves
What are some types of fruits, and how is their form adapted to their function?
Fleshy –> attract animals to eat them via bright colours, scents; “flesh” of fruits to be eaten, but seeds have tough indigestible seed coats (to pass through digestive system unharmed); contain hairs/waxes/chemicals to deter insect feeding b/c insects won’t disperse seeds but can eat flesh
Dry –> light & aerodynamic (wind-dispersed); fibrous & light (to not sink, water-dispersed); edible, sweet (animal dispersed); exploding to move further, hooks to stick to fur (other strategies)
