L5 - biological models Flashcards
Learning objectives of the lecture
- Explain the emergence of anxiety and mood disorders from an evolutionary perspective [analyse].
- Describe [paraphrase] the main research findings of genetics and environment in the development of anxiety and mood disorders and argue the strengths and weaknesses of different types of research [evaluate].
- Describe the basic ideas of molecular mechanisms (genetics and epi-genetics) relevant to anxiety and mood disorders [paraphrase].
- Summarize a vulnerability model of genetics and environment to anxiety and mood disorders [analyse].
- Describe the critical neurotransmitter systems and their relationship to anxiety and mood disorders [paraphrase].
- Explain the current state of affairs regarding antidepressants in the treatment of anxiety and mood disorders [paraphrase]: their effectiveness, the potential mechanisms, but also what is not yet known [analyse]
Does nature or nurture cause mental disorders? What alternative debate about causes is a more useful approach?
Since both nature and nurture contribute to mental disorders, it’s more useful to consider ultimate vs proximal causes
What are ultimate and proximal causes?
Picture 1
- Think of a timeline – ultimate very long time ago, proximal something more recent
- Ultimate cause: evolutionary cause that is also shaped by the environment – certain evolutionary pressures
- More proximal but more somewhere in the middle – available resources – stressors
- Afterwards parenting style – influence development of the brain, all interacting with genetics and environment
- Most proximal: social interactions, trauma
- Biology and environment (nature and nurture) are always together in all of those cases and steps in the timeline
How do traits develop according to Charles Darwin?
Need some variation, reproductive benefit of that variation, pressures where these traits can be beneficial – certain traits can develop (e.g. long necks of giraffes)
Do psychological mechanisms work in the same way as Darwin proposed about biological variation?
To some extent yes, for example experiencing negative emotions - in the case of fear
!But certainly not DSM diagnoses as they don’t have an evolutionary benefit
Is there one ‘optimal adaptation’?
Optimal adaptation = refers to the idea of a single, best way for psychological mechanisms to function across all environments
- no universal optimal adaptation exists because the effectiveness of psychological traits depends on context and individual differences
- What is adaptive in one context may not be in another
What role do emotions play in survival and how does that help explain that the adaptation depeds on context and individual differences?
- Emotions function as signal detection systems that help organisms identify and respond to fitness-relevant situations in their environment
↪ Based on Signal Detection Theory, which describes how systems (like our brains) balance the risk of false positives (responding to a non-threat as if it were a threat) and false negatives (failing to respond to an actual threat) - Emotions trigger physiological, cognitive and behavioural changes that prepare an organism to respond
- Emotional systems have been shaped by natural selection to minimize the most costly errors
- Psychological mechanisms prioritize survival over accuracy = it’s safer to overreact (e.g., anxiety as a false alarm) than to miss real threats
↪ smoke detector principle = fear and anxiety are tuned to overreact because the cost of a false negative (failing to detect a real threat) is often much greater than the cost of a false positive (mistakenly perceiving a threat when there is none) - Emotions regulate the allocation of cognitive and behavioral resources based on the expected risks and rewards in an environment
This whole thing is the idea of adaptive framework
What does the extent to which psychological mechanisms are sensitive or alert to potential threats or stimuli depend on?
-
Probability of an event:
↪ If a threat is likely (e.g., encountering snakes in the wild), heightened alertness is more adaptive
↪ If the threat is unlikely (e.g., fearing snakes in a city like Amsterdam), this sensitivity may be less logical or useful. -
False negatives (the cost of missing a real threat): the cost of not detecting a real danger can be severe (e.g., failing to notice a snake could lead to harm)
↪ In risky environments, the brain may prioritize avoiding false negatives by being extra cautious -
False positives (the cost of wrongly identifying something as dangerous): the cost of mistakenly perceiving danger (e.g., thinking a rope is a snake) is usually minor.
↪ Over-alertness may cause unnecessary stress but is safer than missing a real danger - Changes in environment
How do moods and emotions differ in their role of detection?
While acute emotions act as immediate detection mechanisms, mood serves as a longer-term integration system that adjusts detection thresholds based on past experiences
How do rewards and punishments relate to the evolutionary fitness theory?
- punishments are stimuli that can be used to decrease the frequency of a behaviour
↪ things whose experience negatively covaries with fitness (toxins, isolation) - Rewards are stimuli that can be used to increase the frequency of a behaviour
↪ things which positively covaries with fitness over evolutionary time (food, mates) - natural selection will favour mechanisms that lead to strategies that maximize the capture of reward whilst minimising the exposure to punishment
What is the two-dimensional framework which explains the reward and punishment threshold?
Picture 2 and 3
Threshold for responding to potential punishment (threat sensitivity):
- people witih a lower punishment threshold readily interrupt other activities to focus on potential dangers
↪ vigilance, sleeplessness, hyperarousal, and attentional biases towards threat cues leads to an anxious mood - a higher threshold leads to a relaxed state and the behaviours mentioned above are missing
Threshold for responding to potential rewards (reward sensitivity):
- people with a lower reward threshold are ready to initiate in reward-approach behaviour when given only minimal cues that a reward might be available
↪ leads to an optimistic, motivated state, with attentional biases towards reward-related stimuli - people with a higher reward threshold are more reluctant to o initiate reward-approach behaviour: they feel that it won’t be pleasurable, that they probably won’t succeed and that they don’t have the energy to try
↪ leads to a depressive state
How can we use this framework to classify moods?
This framework allows for four major mood types:
- Positive mood (high reward sensitivity, low threat sensitivity)
- Anxious mood (high threat sensitivity, low reward sensitivity)
- Depressed mood (low reward sensitivity, high threat sensitivity)
- Relaxed state (low threat sensitivity, high reward sensitivity)
How do thresholds and hence moods adapt based on past experiences over time?
Moods help adapt instead of resetting after each experience
- Environmental predictability: today’s conditions predict tomorrow’s
- An individual who experiences a punishment sets a lower threshold for the detection of punishments in the next period of time, and an individual experiencing reward sets a lower threshold for the detection of reward in the next period of time
- a negative experience provokes an acute response (emotion, e.g. fear), but also an adjustment of expectations about future experiences
- Individual differences: an individual’s physical condition affects the cost-benefit balance of actions
- If an organism is weak, it should be more cautious, leading to lower reward-seeking behavior and higher threat sensitivity
- Environment & Condition interact: : bad experiences predict future risks and weaken the individual, making more adjustment critical
Moods help individuals survive by adjusting behavior based on past experiences
What does then this adaptive mood model predict?
- Environments with consistent rewards should foster an optimistic mood
- Environments with frequent threats should induce anxiety
- A resource-poor environment should lead to depressive-like states, reducing risk-taking behaviors
What empirical evidence is there that supports this adaptive model?
- Depression is often triggered by prolonged exposure to non-rewarding environments (e.g., unemployment, loss)
- Anxiety is linked to past threats (e.g., exposure to danger leads to heightened threat detection)
- Physical limitations (e.g., illness, malnutrition) correlate with both depression and anxiety
- Animals also adjust their behavior based on prior experiences of threat and reward
How does mood result in cognitive bias?
Mood influences how ambiguous stimuli are interpreted
Individuals in a depressed or anxious state tend to:
- Interpret ambiguous information negatively
- Focus more on threats than potential rewards
- Display cognitive biases in decision-making
What empirical evidence is there that supports the cognitive bias in relation to mood?
- Depressed individuals are more likely to interpret ambiguous faces as sad
- Anxious individuals focus more on negative stimuli
- Rats exposed to chronic stress are less likely to engage in reward-seeking behaviors
Such findings reinforce the argument that mood systems regulate behavior by adjusting decision-making thresholds
What alternative function for mood disorders does the paper present?
Mood disorders are not necessarily malfunctions but extreme manifestations of adaptive processes:
- Depression might have evolved to reduce futile effort in harsh environments
- Anxiety could enhance survival in dangerous settings
- Comorbidity of anxiety and depression might be explained by the cumulative effect of negative experiences on both reward and threat sensitivity
Why is this problematic in modern society?
However, while these mechanisms may be beneficial in ancestral environments, modern society presents mismatches:
- Chronic stressors (e.g., social isolation, economic hardship) can trigger prolonged mood responses that were originally designed for short-term environmental adaptation
- Modern treatments (e.g., antidepressants) often target the symptoms rather than the underlying adaptive function of mood
Genetics overview
- Nuclei contains chromosomes
- Chromosome consists of Deoxyribo Nucleic Acid
- DNA consists of sugar-phosphate backbone + “base-pairs”
- Genes = sequence base pairs: ACTGGGCTACTACACAAACC
- sequence of base pairs becomes active when DNA is turned into RNA which codes for proteins
- Mutations can occur, and these are heritable
↪ most of the time all fine but some disorders stem from these mutations when they have negative effect
What different methods are there in behavioural genetics?
- Family studies
- Adoption research
- Twin research (very valuable)
- Monozygotic (MZ); 100% genetical identical
- Dizygotic (DZ); on average 50% genetical identical
- Twin studies compare the similarity between monozygotic (MZ, identical) twins and dizygotic (DZ, fraternal) twins to estimate genetic and environmental contributions to a trait
What insight about heritability can we gain from twin studies?
Picture 10
Calculate correlations for MZ twins (rMZ) and DZ twins (rDZ).
- Correlation between how strong these disorder traits are related for the monozygotic and dizygotic twins – the relationship is stronger for monozygotic twins than dizygotic twins = indication of genetic component (if something is under genetic control, you would expect MZ to show stronger correlation than DZ)
↪ Any physical trait which has genetic component, the pattern will be the same, the strength might be different
Use these correlations to estimate:
- Additive genetic influence (A = 2(rMZ - rDZ))
- Common environment (C = rMZ - A)
- Unique Experience (or Error - variance that we can’t explain) (E = 1 - rMZ)
Heritability is a statistical estimate, not a direct measure of genetic influence
Example of anxiety and depression on picture 5
- Conclusion: partly heritable, partly unique experience
Is enviornment also heritable?
Research shows that those areas are 6-39% heritable:
- Marital quality
- Social support
- Parental discipline and warmth
- Family environment
- Peer relationships
- One hypothesis on how environment can be heritable: the parental environment is actually similar across children (not always the case and lot of psychologists argue against this)
Genes and environment correlate
What are the three gene - environment correlations?
Picture 5
Some genetic influences affect the type of environment a person is exposed to. These correlations can be:
- Passive: a child inherits genes and is also raised in an environment influenced by parental genes (e.g., musically talented parents provide both musical genes and a musical home environment)
- Reactive (evocative): certain genetic makeup and you show certain behaviour and the environment reacts to that (the things start to go together and the genetic makeup can fuel the environment’s response)
- Active: individuals seek out environments that match their genetic predispositions (e.g., an athletic child chooses to play sports).
Core reason why it’s hard to tear apart the genes and environment when trying to figure out which causes what
How do genetic predisposition interact with environmental factors and what moderates this interaction?
Genetic predispositions may interact with environmental factors to influence behavior, e.g. a person with a genetic risk for depression may only develop symptoms if they experience significant stress
- Potential mechanism: epigenetics – changes in gene expression caused by environmental influences (e.g., stress, diet, trauma) without altering the DNA sequence
↪ environmental factors can turn genes “on” or “off,” affecting behavior - There is an interaction of genotype and behaviour but it’s moderated by environment
- Certain genetic makeup comes about in a different ways in different settings (the case with mapd)
Picture 11
What is the problem with gene-environment research?
It faces replication issues
- major issue in behavioral genetics and psychology, as some gene-environment interactions may be harder to confirm than originally thought
What is molecular genetics?
Focuses on mechanisms of genes at a biochemical level
- how genes work within cells and how genetic variations contribute to traits and diseases
What does the graph in picture 6 mean?
Shows relationbetween frequency of genetic variation occurring and effects of genes on psychiatric disorders (effect size)
- Negative relationship – the more often a gene occurs, the less of an influence it has on a disorder – makes evolutionary sense
- If a certain genetic makeup would be detrimental – wouldn’t make sense that it would occur a lot in general population – evolutionary perspective (not beneficial so wouldn’t get selected)
What are Manhattan graphs and what do they show?
Manhattan graphs: genetic contribution to disorder per chromosome
- visualize genetic variants (SNPs) associated with a particular trait or disease
- Y-axis: measure of effect size – the higher it is the more influence the genetic variant has on the disorder
- Gives a nice intuition about the genetic makeup of mapd
- There are many genes scattered around different chromosomes with lot of variation that contribute to the disorders = polygenetic effects
- If only one chromosome – one dot and high up
What neurotransmitter systems in the group mono-amines do we have?
- Dopamine - Ventral Tegmenal Area
- Norepinephrine - Locus Coeruleus
- Serotonin - Raphe nucleus
They are most closely related to the medications prescribed to the patients with mapd
How do neurotransmitters work?
- An electrical signal (action potential) travels down a neuron - neuron gets activated
- At the end of the neuron, the signal triggers tiny sacs (vesicles) to release neurotransmitters into the gap between neurons (synaptic cleft)
- The neurotransmitter crosses the gap and attaches to special receptors on the next neuron
- Signal is passed on or blocked - depending on the neurotransmitter, the next neuron is either:
→ Excited (it continues the signal)
→ Inhibited (it stops the signal) - To prevent overstimulation, the neurotransmitter is removed by:
→ Reuptake (it’s taken back into the first neuron)
→ Breakdown (enzymes destroy it)
→ Diffusion (it drifts away)
What is the history of psychopharmacology for MA(PD)?
1950s: Monoamine oxidase inhibitors (MAOIs)
- Tricyclic antidepressants (TCAs)
1980s: Selective serotonin reuptake inhibitors (SSRIs)
- Bupropion
1990s: Serotonin norepinephrine reuptake inhibitors (SNRIs)
- Mirtazapine
What is the historical perspective on antidepressant efficacy?
- Early Beliefs: In the past, it was believed that antidepressants were effective in about 70% of patients, while placebo worked in 30%
- Initial Findings: Kuhn’s early trials with imipramine indicated that only patients with endogenous or melancholic depression were most likely to respond
- Shift in Diagnostic Criteria: The introduction of DSM-III in the 1980s led to a broader definition of major depression, incorporating mild and moderate cases, which may have diluted antidepressant effects
- Public domain FDA data revealed that symptom reduction was 40% with antidepressants and 30% with placebo, contradicting the earlier 70% efficacy claim.
↪ These findings suggest inflated expectations in early research
What is the assumption about antidepressants and their effect on the neurotransmitters?
All antidepressants affect levels/activity of serotonin, norepinephrine and dopamine – influences the transmission from one synapse to another
Therefore, disrubtance of chemical imbalance of depression = depression is a serotonin disorder
Do we actually know how the effect of antidepressants is created on NT levels?
- Not enough evidence whether depression is related to high or low levels of neurotransmitters
- Not clear how antidepressants work on NT levels
- There are some theories (e.g. SSRI block serotonin reuptake so more NT) but we don’t know how it actually works
What is a major problem with the use of antidepressants?
Even though we don’t know they are still being widely prescribed for many disorders
- In Netherlands: >1.000.000 users
- Prescribed for many different disorders, e.g. OCD, anxiety, personality disorders
How do we measure whether antidepressants are effective?
Studied with randomized control trials (RCTs) – measure depressive symptoms pre and post and compared to placebo
- pre-post score on depression rating scale (e.g. HAM-D)
- the higher, the better (more symptom reduction)
- This can be standardized (comparable for different symptom rating scales): Cohen’s D
How effective antidepressants are?
- Effect size for depression and anxiety disorders, compare to placebo D = 0.3 (moderate effect)
- But the total effect (not compared to placebo) is much larger: D = 0.8-1.4
This (might) explain why docters and researchers think differently about antidepressants…
- Clinicians see the effectiveness of AD in clinical practice - but they are lacking the info on how would this client improve with a placebo
Critical note: Consider the benefits of ADs compared to placebo
How can we break down the effects of placebo and AD?
Picture 8
Natural course – people seek help when things are worst, things improve on their own
The effectiveness of both is based on lot of things but the specific pharmacological effect of AD is just one of them and not even the biggest one
Is placebo effect real? What are some importnat questions we have to ask ourselves?
- Not a biological active substance but it does have a biological effect → Brain scan shows some areas lighting up
- the small drug-placebo differences is not unique to depression: illnesses that are chronic, have a fluctuating course and are associated with subjective distress are prone to placebo response (e.g. hypertension)
- Previously thought that depressed patients would relapse quickly after placebo treatment - not so true they remain well for usually 6 mnths or longer
- If it’s effective, should it be prescribed to patients? Is it ethical?
↪ Still controversial, new research; open-labelled placebo might also work - Not as effective as psychotherapy - good to compare those two but difficult since psychotherapy is hard to be delivered as placebo
Why has it taken so long to realise the caveats?
- Still controversial to criticise AD
- Publication bias - research is often funded by pharma companies which have something to lose (concern about possible false positive results - their trails may not be the best design and conduct)
What are different forms of the publication bias?
- Publication bias - Some studies are not published at all
- Reporting bias - Some (negative) studies were published, but with suddenly positive results
- Spin - some (negative) trials were published with negative results, but somehow still concluded that the drug is effective
What is the problem with these forms of publication bias (and pb in general)? How does it then reflect on what studies get actually published?
Picture 9
What is important to realise when it comes to the prescribing AD and why that might be dangerous?
SSRIs are not harmless drugs – that’s why it’s important to consider their effectiveness because the side effects are serious (mostly suicide which increases)
How does the likelihood of active drug influence placebo response?
If the study has three arms: two active groups and one placebo group – the likelihood of getting the drug increases and the participants know this
- Once the likelihood increases, the scores increase (higher values = bigger pre-post difference - better)
- The more likely you are to get the treatment, the more you improve even if you get placebo
- Also the difference between effectiveness of placebo and the drug decreases as the likelihood of getting the drug increases
- Expectation effects - simply expecting an active treatment enhances response
What is the ‘mainstream’ conclusion whether AD work?
→ “yes” (a bit) better compared to placebo (small effect, d ~ 0.3)
… Is this clinically relevant/significant?
…comparable to psychotherapy! (and combined it works better)
The use of and knowledge about antidepressants is not balanced
More positive conclusion
However! We have to consider the 4 critical notes raised. What are they?
- Consider the benefits of ADs compared to placebo
- Publication bias
- Side effects
- Likelihood of active drug influences placebo response
What is the ‘critical’ conclusion whether AD work?
Consider the critical notes and…
- Placebo-run in phases: selection of patients in clinical trials who don’t respond to placebo
- Effects of AD are only shown on short term
So we’re not really sure the effectiveness and actual benefits
