Intro to Microbiology Flashcards
Name 5 things you need for a successful PCR
-final nucleotide (3’) to be G or C
-GC content to be between 40-60%
-Tm to be between 65-75 degrees
-Tm of primers should be within 5 degrees of each other
-the delta G of any shape should be more positive than 9kcal/mol
Describe the method of PCR (3 marks)
-the temperature is increased to 95 degrees to break hydrogen bonds and split the DNA into single strands (denaturing)
-temperature is decreased to 55 degrees so that primers can attach (annealing)
-enzyme DNA polymerase then attaches complementary free nucleotides and makes a new strand to align next to each template (synthesis)
Describe what the temperature should be for the last stage of PCR (synthesis) and why?
temperature should be 72 degrees for this stage, because that’s the optimum temperature for taq DNA polymerase
What would the pair of primers be for this RNA sequence:
>csrB-plus-strand GTCGACAGGGAGTCAGACAACGAAGTGAACATCAGGATGATGACACTTCTGCAGGACACACCAGGATGGTGTTTCAGGGAAAGGCTTCTGGATGAAGCGAAGAGGATGACGCAGGACGCGTTAAAGGACACCTCCAGGATGGAGAATGAGAACCGGTCAGGATGATTCGGTGGGTCAGGAAGGCCAGGGACACTTCAGGATGAAGTATCACATCGGGGTGGTGTGAGCAGGAAGCAATAGTTCAGGATGAACGATTGGCCGCAAGGCCAGAGGAAAAGTTGTCAAGGATGAGCAGGGAGCAACAAAAGTAGCTGGAATGCTGCGAAACGAACCGGGAGCGCGTGAATAC AGTGCTCCCTTTTTTTATT
>csrB-minus-strand CAGCTGTCCCTCAGTCTGTTGCTTCACTTGTAGTCCTACTACTGTGAAGA CGTCCTGTGTGGTCCTACCACAAAGTCCCTTTCCGAAGACCTACTTCGCT TCTCCTACTGCGTCCTGCGCAATTTCCTGTGGAGGTCCTACCTCTTACTC TTGGCCAGTCCTACTAAGCCACCCAGTCCTTCCGGTCCCTGTGAAGTCCT ACTTCATAGTGTAGCCCCACCACACTCGTCCTTCGTTATCAAGTCCTACT TGCTAACCGGCGTTCCGGTCTCCTTTTCAACAGTTCCTACTCGTCCCTCG TTGTTTTCATCGACCTTACGACGCTTTGCTTGGCCCTCGCGACACTTATG TCACGAGGGAAAAAAATAA
GTCGACAGGGAGTCAGACAAC and AATAAAAAAAGGGAGCACTGTATTC
What would be the effect on the PCR reaction if any of the following circumstances arose: 1) there are no primers in the reaction, 2) there are no dNTPs in the reaction, 3) there is no Taq polymerase in the reaction?
the PCR reaction will not take place
What would the generally expected effect on the PCR reaction be of adjustments that increase the temperature of the annealing phase and the length of the elongation phase? Can you explain these results? (3 marks)
precision will be reduced, but yield will increase. increasing the length of the elongation phase will reduce the proportion of incomplete newly-synthesised strands and therefore increase yield
In principle, what is a likely consequence in a failure to separate pre-PCR and post-PCR activities?
false positive reactions
A reduced amount of template in an optimized multiplex PCR reaction should _______ overall yield.
not increase
What would the expected effect be on a PCR reaction if the primers used were slightly shorter and more variable than the intended oligonucleotide sequences?
the reaction would yield a mixture of non-specific products
What is the reverse complement of the given sequence 5’-GCTAAAA-3’
TTTTAGC
What’s Selective Media
a media which favours the growth of particular organisms, while preventing growth or kill undesired organisms
What’s Differential Media
a media which allows different organisms to be distinguished based on particular phenotypes
What’s Nutrient agar/ Rich Media
a media which is not selective or differential. permits growth of most organisms apart from fastidious microbes
Is MacConkey selective and/or differential
both, selective (through bile salts and crystal violet) and differential (through lactose and crystal red)
Is Mannitol Salt Agar selective and/or differential
both, selective (through sodium chloride) and differential (through D-mannitol and phenol red)
