Genetics Flashcards
Gene
A segment of DNA containing enough codons to produce all amino acids for one protein.
Example: ATTGACTACCGGTACGAATCG
Beadle and Tatum’s One Gene-One Polypeptide Hypothesis:
Concluded that genes direct the production of only one enzyme.
Vernon Ingram, One Gene-One Polypeptide Hypothesis:
Demonstrated the one gene-one polypeptide hypothesis by studying hemoglobin in individuals with sickle cell anemia. He concluded that a gene specifies the type and location of each amino acid in a polypeptide chain.
Examples: Hemophilia, cystic fibrosis.
Codon
A sequence of three mRNA bases (e.g., AUG) that codes for a specific amino acid.
Start Codon
AUG (signals translation start).
Stop Codons
Signal translation stop.
Triplet
A group of three nucleotides in DNA/RNA coding for an amino acid.
Anticodon
A complementary trinucleotide sequence on tRNA corresponding to an mRNA codon.
Amino Acid
Molecules that combine to form proteins.
DNA
A double-stranded helix held together by hydrogen bonds between base pairs.
Base Pairing (what pairs with what, and how?)
Adenine (A) pairs with Thymine (T) via 2 hydrogen bonds.
Cytosine (C) pairs with Guanine (G) via 3 hydrogen bonds.
Nucleotides (3 components)
5-carbon sugar (deoxyribose).
Phosphate group (C5).
Nitrogenous bases: Pyrimidines (C, T) and Purines (A, G).
Directionality
DNA is read 3’ → 5’ and synthesized 5’ → 3’.
3’ end: Hydroxyl group (-OH).
5’ end: Phosphate group.
Frederick Griffith (1928)
Discovered bacterial transformation.
Avery, MacLeod, McCarty (1944)
Identified DNA as the transforming principle.
Hershey-Chase (1952)
Proved DNA is the hereditary material using bacteriophages.
Erwin Chargaff (1950)
Developed Chargaff’s rules (A=T, C=G).
Rosalind Franklin (1952)
X-ray diffraction revealed DNA’s double helix.
Watson and Crick (1953)
Built the DNA double-helix model.
Meselson-Stahl (1958)
Demonstrated semiconservative DNA replication
DNA Replication: Key Steps
- Unwinding the DNA
- Priming
- Elongation
- Joining Fragments
- Unwinding the DNA
Helicase -
Unzips the DNA.
1.Unwinding the DNA
Topoisomerase -
Prevents overwinding.
- Unwinding the DNA
SSBs -
Stabilize separated strands.
- Priming
RNA Primase: Lays down RNA primers.
- Elongation
DNA Polymerase III
Synthesizes new strands (5’ → 3’).
- Elongation
Leading Strand
Continuous synthesis.
- Elongation
Lagging Strand
Discontinuous synthesis with Okazaki fragments.
- Joining Fragments
DNA Ligase
Seals gaps
Key Enzymes
Helicase, Topoisomerase, SSBs, RNA Primase, DNA Polymerase I/III, DNA Ligase.
Protein Synthesis: 2 main steps
Transcription & Translation
Where does transcription take place?
Nucleus
Transcription steps
- Initiation
- Elongation
- Termination
Initiation
RNA polymerase binds to promoter regions (e.g., TATA box).
Elongation
RNA polymerase synthesizes mRNA complementary to the template strand.
Termination
RNA polymerase releases the mRNA transcript.
Post-Transcriptional Modifications:
5’ Cap, 3’ Poly-A Tail: Stabilize mRNA.
Splicing: Removes introns, joins exons.
Where does translation occur?
Cytoplasm
Steps of Translation?
- Ribosomes bind mRNA at the start codon (AUG).
- tRNA matches anticodons to mRNA codons, carrying amino acids.
- Ribosome links amino acids with peptide bonds.
- Process ends at stop codon.
2 Main Types of Mutations?
- Point Mutations
- Frameshift Mutations.
Types of Point Mutations
Silent, Missense, Nonsense
Silent Mutation
No change in protein.
Missense Mutation
Changes one amino acid.
Nonsense Mutation
Introduces a stop codon.
Framseshift Mutation:
Insertions/deletions alter the reading frame.
What are Restriction Enzymes
Cut DNA at specific sites (sticky/blunt ends).
What is Recombinant DNA?
Combines DNA from different sources.
What are plasmids?
Circular DNA for gene insertion.
What is Gel Electrophoresis?
Separates DNA by size
What is PCR?
Amplifies DNA
What is CRISPR-Cas9?
Precise gene editing
Gene Control In Prokaryotes
Lac Operon: Induced by lactose to digest the sugar.
Trp Operon: Repressed by tryptophan to stop its production.
Gene control is eukaryotes
mRNA Processing: Introns removed, exons joined.
Alternative Splicing: Produces multiple proteins from one gene.
