Fragen zu den Vorlesungen Flashcards
Synapses differ in morphology according to their postsynaptic membrane: Name the three different types depending on the structures from where onto where they’re localized.
(VL Marta; last edit: Inga, 9.3.).
- axodendritic synapse: from axon onto dendrite, usually excitatory
- axosomatic synapse: from axon onto soma, usually inhibitory
- axoaxonic synapse: from axon onto axon, usually modulating (can modulate other synapses by inhibition of facilitation)
Describe the two different types of synapses depending on their signal transmission.
(VL Marta; last edit: Inga, 9.3.)
- chemical synapse: information is transferred through the release of neurotransmitter from one neuron and their detection by an adjacent cell
> AP arrives at axon terminal -> depolarization
> voltage-gated Ca2+ channels open, Ca2+ enters the axon terminal
> Ca2+ causes NT-containing SV to release their contents bei exocytosis
> NT diffuses across synaptic cleft, binds to ligand-gated ion channels on postsynaptic membrane and enters postsynpase -> changes in membrane potential of postsynaptic membrane (EPSPs or IPSPs) - electrical synapse: cytoplasm of adjacent cells is directly connected by clusters of intercellular channels (gap junctions)
> fast (no synaptic delay) and bidirectional
> gap junctions consist of connexon (= half channel) consisting of several connexins
> selective interaction between connexons -> electrical coupling (depends on connexin connection), transmission of metabolic signals (IP3, cAMP)
> GJs are permeable to ions and molecules < 1kDa
> synchronization of large neuronal ensembles
Briefly describe the barrel cortex in mice.
VL Marta; last edit: Inga, 9.3.
- region of the somatosensory cortex with remarkably high degree of organization
- contains clear pattern of cytoarchitectonic units called ‘barrels’, exclusively found in neocortical layer 4
- barrels are arranged like whiskers on the snout of the mouse: each barrel corresponds to a whisker
- information from whiskers -> cerebellum -> thalamus -> barrel cortex -> motor cortex -> whiskers
What is a tripartite synapse?
VL Marta; last edit: Inga, 9.3.
- refers to the connection and interaction between pre- and postsynaptic membrane and the surrounding glia cell and their combined contribution to the production of activity at chemical synapses
- can for example be found at several locations in the central nervous system with astrocytes
What is Synapto-pHluorin and what is it used for?
VL Marta; last edit: Inga, 9.3.
Synapto-pHluorin consists of a pH-sensitive form of GFP and a vesicle-associated membrane protein (VAMP) and is used as an optical indicator of vesicle release and recycling. It is auto-quenched and therefore non-fluorescent inside the SV due to the acidic pH but when released into the more alkaline extracellular environment/synaptic cleft, the presynaptic terminal becomes fluorescent. The SV become re-acidified by endocytosis and the cycle starts again.
Describe the difference between excitatory and inhibitory synapses.
(VL Marta; last edit: Inga, 9.3.)
- excitatory synapses: ion currents flowing through ion channel cause a DEpolarization of postsynaptic cell which in turn fires an AP
> more than 90% of excitatory glutamatergic synapses in mammalian brain occur on dendritic spines
> asymmetric synapses: pronounced postsynaptic densitiy (PSD)
-> ionotropic glutamate receptors: AMPAR, NMDAR
-> scaffolds: PSD95, Shank, Homer
-> cell adhesion: neuroligins, N-Cadherin - inhibitory synapses: ion currents flowing though ion channels cause a HYPERpolarization of postsynaptic cell which in turn stops firing AP
> inhibitory GABAergic synapses occur primarly on somata, shafts of dendrites and axon initial segments
> symmetric synapses: only slight electron-dense thickening at postsynaptic membrane (less elaborate specialization)
-> GABA(a) receptors, glycine receptors
-> ion: Cl-
-> scaffold: Gephrin (interacts with receptors)
-> cell adhesion: neuroligins
Presynaptic proteins at the AZ of vertebrate synapses.
VL Marta; last edit: Inga, 9.3.
- Actin
- Abp1
- Piccolo
- Bassoon
- PRA1
- CAST/ERCs (= BRP homologue)
- Liprin-α
- Spectrin
- RIM
- Rab 3
- RIM-BP
> localization of RIM-BP2 at AZ in mouse hippocampal synpases: close to Basson (98nm) and Munc13-1 (115nm), distance between Bsn and Munc13-1 is 116nm - Munc13
- Synaptobrevin
- Syntaxin
- SNAP25
What are hippocampal mossy fibres?
VL Marta; last edit: Inga, 9.3.
- part of the hippocampal neural network -> hippocampus is crucial for memory and learning
- project from dentate gyrus to CA3 (involved in short-term memory)
- filopodial extensions (‘feet’ of axonal growth cone during exploratory growth) of mossy fibre synapses are specialized to innervate GABAergic cells
What are the advantages of a chemical synapse?
VL Niraja; last edit: Inga, 9.3.
- signal amplification: signal is not dampened over long distances like in electrical synapses
- inhibitory synapses are only possible through chemical synapses
- high flexibility through differing strengths, transmitter and receptor identities, modulation based on experience, modulation through feedback mechanisms etc.
What is quantal release?
VL Niraja; last edit: Inga, 9.3.
- each SV contains a ‘quantum’ of NT packed inside of them
- mini excitatory/inhibitory postsynaptic potentials result from spontaneous vesicle fusion in the ABSENCE of presynaptic electrical activity
- in contrast, an AP results in a brief, accelerated, synchronous secretion of quanta to evoke a postsynaptic potential
- the most important thing in release is Ca2+
Describe the differences between nano- and microdomain coupling between synaptic vesicles and Ca2+ channels.
(VL Niraja; last edit: Inga, 9.3.)
- nanodomain: very small coupling distance (< 50nm) between Ca2+ channel and SV
> high initial SV release probability
> depressing
> less sensitive for Ca2+ buffers - microdomain: larger coupling distance (> 50nm) between Ca2+ channel and SV
> low initial SV release probability
> facilitating
> sensitive for Ca2+ buffers
=> high Ca2+ around the channel means that SV in this area have a high release probability and as the concentration falls further away from the channel, there is a low(er) release probability
In regards to SV release, what happens in BRP mutants?
VL Niraja; last edit: Inga, 9.3.
- impaired vesicle release: severe deficitis in evokes SV release
- same in RIM-BP mutants
- caused by a mislocalization of presynaptic Ca2+
=> suggests that brp localization is important for the accumulation
What do Syd-1, Nrx-1 and Nlg-1 mutants have in common?
VL Niraja; last edit: Inga, 9.3.
- larger actives zones which are fewer in number (at the NMJ)
What is Syd-1?
VL Niraja; last edit: Inga, 9.3.
- presynaptic scaffold protein (DSyd-1 in Drosophila)
- acts together with Nrx-1 and Ngl-1 for normal configuration of AZs
- has PDZ binding domain and binds Nrx-1 through it
- > Syd-1 and Nrx-1 bind each other directly
- is dragged to membrane by Nrx-1 and being localized to AZ
- > Syd-1 influences localization of Nrx-1 at NMJ
- > Nrx-1 is more mobile in Syd-1 mutants
- “early scaffold” together with Liprin-α (and Unc13B)
What is spinophilin?
VL Niraja; last edit: Inga, 9.3.
- presynaptic protein highly enriched in dendritic spines
- in competition with Syd-1 for binding Nrx-1
- spn mutants have smaller active zones that are higher in number (opposite to Syd-1 mutants)
- forms a less tight complex with Nrx-1 than Syd-1
-> when binding to Nrx-1, Nrx-1 switches from binding Ngl-1 to Ngl-2 - PDZ is imporant because of its binding to Nrx-1 and thereby stopping new AZs from being formed
-> establishing a threshold for AZ assembly as it’s operating as a “sponge” for Nrx-1? - role for AZ structure depends on PDZ domain ligand binding
- controls BRP-complex incorporation during structural plasticity
> binds via CC region the conserved BRP/ELKS-N-terminus
> essential for fast structural plasticity (after 10min)
What are the “early scaffold” and the “late scaffold”?
VL Niraja; last edit: Inga, 9.3.
- early scaffold: arriving early in formation/configuration of an AZ
> Syd-1, Liprin-α and Unc13B - late scaffold: arriving later in formation/configuration of an AZ
> Brp, RIM-BP and Unc13A
-> Brp and Unc13A predict evoked release at single AZ level
What is “loose” and “tight” Ca2+ sensor/channel coupling?
VL Niraja; last edit: Inga, 9.3.
- loose Ca2+ sensor/channel coupling: initial Unc13B mediated glutamate release
- > de novo synapse formation
- tight Ca2+ sensor/channel coupling: presynaptic BRP/RBP/Unc13A and postsynaptic GluRIIB incorporation
- > mature synapse
What are the hallmarks of a good experimental design?
VL Tina, last edit: Inga, 9.3.
- formulate question/goal in advance
> simple, clear, should be possible to answer - comparison/control
> good experiments are comparative: circumstances in different experimental groups (EGs) should be as equal as possible with only ONE thing changig
> EG should rather be compared to concurrent controls than historical ones - replication
> needed to show variation within EG: reduce effect of uncontrolled variation (factors you don’t want to influence your data but they do anyway)
> quantify uncertainty: there are always things you can never influence
> an estimate is of no value without some statement of the uncertainty in the estimate: if you don’t have enough replicates, you can’t say anything about the data - randomization
> experimental subjects (“units/N”) should be assigned to EPs at random
> explicit randomization using a computer/coins/dice/cards..
> to avoid bias (Tendenzen)
> to control the role of chance: randomization allows the later use of probability theory, and so gives a solid foundation for statistical analysis
> the more you randomize, the more it reduces personal bias BUT it’s not perfect for every experiment and might make things more complicated - stratification
> strata = levels, sometimes called “blocking” because you create “blocks” aka groups within the EG
> take account of the difference between periods in your analysis
> example: 20 male/female mice to be tested, half treated and half untreated and only 4 animals can be treated per day -> every day a treated and untreated female and an treated and untreated male BUT order of animals is still random
=> randomization and stratification
> if you can (and want to), FIX a variable
> if you don’t fix a variable, STRATIFY it
> if you can neither fix nor stratify a variable, RANDOMIZE it - factorial experiments
> two or more factors: effect of each factor and their interactions on the response variable
> we can learn more and it’s more efficient than doing all single-factor experiments since we can gain more precise results from a factorial experiment
> additive interactions: the effect of all factors is equal to the sum of the effect of the factors taken separately
> interactive interactions: effect of all factors is NOT simply additive
=> other points
> blinding: measurements made by people can be influenced by unconscious biases
> internal controls: for increased precision it can be useful to use the subjects themselves as their own controls
> representative ability: are the subjects/whatever that you are studying really representative of the population you want to study?
Summary of the characteristics of good experiments and how they’re achieved.
(VL Tina; last edit: Inga, 9.3.)
- unbiased: > randomization > blinding - high precision: > uniform material > replication > blocking - simple: > protect against mistakes - wide range of applicability: > deliberate variation > factorial designs - able to estimate uncertainty: > replication > randomization > stratification
Describe fluorescence microscopy.
VL Marta; last edit: Inga, 9.3.
- combines magnifying properties of light microscopy with visualization of fluorescence
- fluorescence is the ability of a fluorophore to emit light after getting excited by light of a certain wavelength; the emitted light has longer wavelength as it loses energy during the state of relaxation after excitation
- > Stokes shift = emission curve (and maximum) is shifted towards far red
- accomplished in conjuction with basic light microscope by addition of a powerful light source, specialized filters and a means of fluorescently labeling a sample
- has a resolution limit
What is the resolution of a microscope and how is it calculated?
(VL Marta, last edit: Inga, 9.3.)
- resolution = smallest distance between two points that can still be distinguished
- can be calculated with Abbe’s equation: d = λ/2NA
> NA = numerical aperture = n * sinα
-> α = opening angle; n = refractive index (of immersion media)
=> high NA = higher resolution - for emitting object = Rayleigh criterion: a = 0.61 * λ/NA
What is the numerical aperture?
VL Marta, last edit: Inga, 9.3.
- NA of a microscope objective is the measure of its ability to gather light and to resolve fine specimen detail while working at a fixed object
- NA = n * sinα
> α = opening angle; n = refractive index (of immersion media) - high NA can capture a larger cone of emission light -> higher resolution
What is diffraction?
VL Marta, last edit: Inga, 9.3.
- diffraction = spreading of light
- in the microscope it can occur at the specimen plane due to interaction of the light with small particles/features and at the margins (Ränder) of the objective front lens or at the edges of a circular aperture within/near the rear (Rückseite) of the objective
- diffraction enables observation of magnified images of specimens in the microscope BUT limits the size of objects than can be resolved
What is the Point Spread Function (PSF)?
VL Marta, last edit: Inga, 9.3.
- the PSF is the 3D intensity distribution of the image of a point object
-> tiny fluorescent object will look bigger under microscope than it is due to diffraction of light - PSF defines how a point source appears when imaged with the instrument, ideally it would produce a clear one pixel signal but this is impossible due to optical effects
-> instead it appears as complex 3D shape = PSF - depends on light wavenlength, lens NA and optical aberration of the lense
-> PSF defines resolution of instrument
=> two points closer than the width of PSF can’t be distinguished
What is deconvolution?
VL Marta; last edit: Inga, 9.3.
- mathematical transformation of an image that reduces out of focus light
- done by program/software
- knowing the PSF size allows to remove the PSF blurring influence (blurring is a significant source of image degradation in 3D widefield fluorescence microscopy)
Describe the principle of STED microscopy.
VL Marta; last edit: Inga, 9.3.
- STED = Stimulated Emission Depletion -> PSF shrinking
- two laser beams: regularly focused excitation beam is overlaid with a laser beam inducing stimulated emission and featuring at least one zero-intensity point (= STED laser)
-> STED laser has always a longer wavelength than the fluorescence! - STED laser inhibits fluorescence emission at periphery of excitation: when an excited-state fluorophores encounters a photon that matches the energy difference between the excited and the ground state, it can be brought back to the ground state through stimulated emission before spontaneous fluorescence emission occurs
- STED laser is shaped like a donut via PhaseMod, so emission can only occur at the center of the PSF
- resolutions up to 30-50nm achieved with organic fluorophores
=> increased resolution is obtained by shrinking the PSF via depleting the fluorescence emission in the periphery of the diffraction limited spot using the phenomenon of stimulated emission depletion - pulsed STED: STED pulse immediately follows excitation pulse, most efficient fluorescence inhibition
- continuous wave (CW) STED: ongoing excitation and STED laser, EGFP and live cell imaging (because fluorophores are optimized for one certain excitation wavelength)
What is the “key to achieve super-resolution with STED”?
VL Marta; last edit: Inga, 10.3.
- non-linear dependence of the depleted fluorophores on the STED laser intensity when the saturated depletion level is approached
- > if it would be linear, it would still be diffraction limited
- > Δx = λ / 2n * sin(α) * √ 1 + I[STED] / I[S]
- if the local intensity of the STED laser is higher than a certain level, essentially all spontaneous fluorescence emission is suppressed; by raising the STED laser power, the saturated depletion region expands without strongly affecting fluorescence emission at the focal point because STED laser intensity is nearly 0 there
What is gSTED?
VL Marta; last edit: Inga, 10.3.
- time gated stimulated emission depletion
- fluorescence is recorded after a time delay T[g] after excitation such that fluorophores have time to see enough STED photons
- reduces blurring
What is dual color STED?
VL Marta; last edit: Inga, 10.3.
- to aquire image in two colours
- dyes should have separated excitation spectra
- overlap of emission spectra for stimulated emission at the depletion wavelength because only one STED laser is used
- combining a classic dye and one with a large Stokes shift works best
Apart from STED, what are the other main super-resolution microscopy techniques and how do they work (brief explanation)?
(VL Marta; last edit: Inga, 10.3.)
- patterned illumination: Structured Illumination Microscopy (SIM)
> number of molecules that emit fluorescence are limited in space
> sample plane is excited by patterned wide-field illumination (commonly stripe-shaped pattern); combines with sample structural pattern to form Moiré fringes; Moiré patterns obtained by rotation excitation pattern; algorithm puts all images together and creates super resolution image
> e.g.: reveals localization of newly exocytosed protein in periactive zone - single molecule imaging: Single Molecule Localization Microscopy (PALM/STORM)
> number of molecules that emit fluorescence are limited in time
> resolution depends on localization precision
> initially samples are inactive/nonfluorescent under illumination bei readout laser; activation laser gets turned on/off; localization of molecules; bleaching of activated structure; localization of next structures
> e.g.: 3D STROM reveals structure of axonal cytoskeleton; dSTORM allows to determine the distance between closest neighbouring clusters
What is gene/genome editing?
VL Janine; last edit: Inga, 10.3.
- targeted modification of genetic information in vivo
- techniques that allow the following modifications:
> insertions
> knock-out
> insertion of mutations
> deletions (e.g. of exons)
> correction of defect genes
Which techniques were common before the discovery of CRISPR? What is possible with CRISPR that these techniques lack?
(VL Janine; last edit: Inga, 10.3.)
- 1st generation: Zinc-finger nucleases (ZFN)
> DNA binding = protein based
> relatively short recognition sequence (2x12)
> already in clinical studies
> complex design and production - 2nd generation: TAL-effector nucleases (TALEN)
> DNA binding = protein based
> few/low off-target (long recognition sequence: 2x20)
> clinical studies started
> design and production relatively easy - 3rd generation: CRISPR/Cas9
> DNA binding = RNA based
> relatively short recognition sequence (20)
> design and production extremely easy
> initially high off-target-activity-avoidance-strategies in progress
=> CRISPR allows multiplexing (several mutations at the same time in one cell)!
Explain the CRISPR technique.
VL Janine; last edit: Inga, 10.3.
- Clustered Regularly Interspaced Short Palindromic Repeats
- bacterial mechanism to defend against viruses, used for genome editing
- allows deletion, insertion and/or replacement of bases at a specific gene locus (and controls gene expression)
- enables multiplexing: several mutations in the same cell at the same time
- essential components: CRISPR-RNA (crRNA) resp. guideRNA (gRNA), Cas9 enzyme and PAM (Protospacer Adjacent Motif) sequence
- > design of simple chimeric gRNA (chimera of crRNA and tracrRNA) to target any sequence next to a PAM (NGG, NCC) in the genome
- > gRNA forms complex with Cas9 enzyme and this complex binds to homologue target sequence
- > Cas9 cuts DNA by creating a double-strand break (DSB) in the genome, 3bp upstream of PAM
- -> when only deleting a gene: DSB is afterwards repaired by cell by either non-homologous end joining (NHJEC) or homolohy-directed repair (HR)
- -> when inserting new gene: addtionally host RNA that should be put in, complementary strand to host DNA gets synthesized then
- > control via PCR
- > use Cas9 modification Cas9 nickase to minimize off target effects
description of the procedure in Fragenkatalog:
- > search for homologous sequence for designed gRNAs (many Gs and Cs) to bind to
- > gRNAs detect homologues areas via PAM structure
- > homologous arm are designed
- > Cas9 endonuclease cuts genomic target DNA and creates DBS
- > DBS can be repaired by homologous recombination with cassette that is to be inserted or by non-homologous recombination
- > single strand breaks are repaired by homologous recombination with the integrated cassette
- > control via PCR
What is the difference between NHEJ and HR in CRISPR?
VL Janine; last edit: Inga, 10.3.
- are the two major repair pathways of double-strand breaks
- NHEJ = non-homologous end joining
> create knock-outs
> more error-prone
> creates indels (merge of insertion and deletion)
> utilizes no template
> occurs with higher frequency - HR= homology-directed repair
> create knock-ins, fusions, etc.
> requires a homologous template (donor)
> inefficient but more accurate
Briefly describe what was done with CRISPR to the flies we used in the single fly PCR.
(Prakt. Alex; last edit: Inga, 10.3.)
- CRISPR was used to remove the exon that is coding for Unc13B -> K.O. of Unc13B
- dsRed was used to check if the deletion actually worked: foreign DNA and marker; repairing system for deleted exon (via homologous areas at “margins” of deleted exon)
- > Unc13B coding exon was “switched” with dsRed casette
- dsRed is also a promoter that is only expressed in the eyes of the flies -> flies with fluorescing eyes lack Unc13B
Name the ingredients of a PCR master mix.
Prakt. Alex; last edit: Inga, 10.3.
- 10x buffer: stabilizes chemical environment for DNA polymerase
- forward and reverse primer: determine starting point of DNA synthesis and limit it
- dNTPs: for synthesis of complementary strand
- DNA polymerase: replicates DNA
- ddH2O
- template DNA
Describe the three major steps of a PCR.
Prakt. Alex; last edit: Inga, 10.3.
PCR stands for “polymerase chain reaction” and it’s a method used for DNA amplification. The procedure consists of three major steps.
1. Denaturation: The DNA that is supposed to be amplified gets denaturated at a high temperature (~95°C), so the primer can later on bind to the single strand). The hydrogen bonds between the complementary bases are broken and the double-stranded DNA template gets split up into two single-stranded DNA molecules.
2. Annealing: The temperature is reduced to so-called “annealing temperature” (usually ~60°C) of the specifically designed forward and reverse primer. The temperature has to be low enough to allow hybridization of the primers to the DNA stand and high enough for the hybridization to be specific.
3. Elongation: Temperature depending on DNA polymerase that is used in the setup. Polymerase synthesizes a new DNA strand complementary to DNA template strand by adding deoxynucleoside triphosphates (dNTPs) from the master mix that are complementary to the DNA template in 5’-to-3’ direction.
These three steps are one cycle. For proper amplification, several cycles are necessary.
What is important for primer design for a PCR?
Prakt. Alex; last edit: Inga, 10.3.
- primer should be 18-25bp/MER long
- should end with G or C at the 3’ end (stronger binding force)
- they are designed from 5’ to 3’
- melting temperature shouldn’t be more than 5°C apart between fwd /rev primer
(- 3 to 4 nucleotides are added 5’ of the restriction enzyme site in the primer to allow for efficient cutting)
=> example
5’ - AATGGAGGTGGTCCTGGAGAAGTGGGATTACGT…- 3’
5’ - GTGCAAGTTAGCAAGGTGAAAAAACGAACGCGA…- 3’
FWD: AATGGAGGTGGTCCTGGAGAAGTGG
-> polymerase attaches to 3’ end and continues to synthesize in 3’ direction; as primers are desgined 5’ to 3’, here the complementary strand is synthesized, so fwd primer is actually DNA strand
RVS: TCGCGTTCGTTTTTTCACCTTGC
-> see above, rvs primer is complementary strand BUT written the other way round
How can you verify by PCR (or phenotypic markers) which fly contains the desired DNA sequence?
Where would you choose specific test primers to bind in order to check if your gene of interest has been integrated into the plasmid?
(Prakt. Alex; last edit: Inga, 10.3.)
- phenotypic markers: e.g. GFP
- PCR: design Primers that are within the desired DNA sequence or flanking it -> PCR won’t work if the DNA sequence where the primer binds isn’t present
- design primer for homologous areas (present in WT and genomically edited DNA) and another one specifically for the insert/gene of interest -> primer designed for insert can’t bind to WT DNA as there’s no insert, PCR doesn’t work (no amplification) and no band can be seen in the gel after gel electrophoresis whereas the genomically edited DNA gets amplified and shows a band in the gel
What is proteomics?
VL Janine; last edit: Inga, 10.3.
Proteomics is the analysis of the entire protein complement of a cell/tissue/organism. It includes large-scale investigation of proteins, their structure and physiological role or functions. In proteomics we distinguish between functional proteomics, structural proteomics, posttranslational modifications and protein-protein interactions.
What is subcellular fractionation?
VL Janine; last edit: Inga, 10.3.
- cell fractionation = process to separate cellular components while preserving individual functions of each component
- subcellular fractionation is also used to provide an enriched source of a protein for further purification
- e.g. isolation of synaptosomal fraction from fly heads
> fly head homogenate -(centrifugation)-> P1 pellet and S1 supernatant -(centrifugation)-> S2 supernatant and P2 pellet = synaptosome-enriched fraction -> analysis of subfractions taken during the procedure in coomassie-staining (and Western Blot?)
What is co-immunoprecipitation?
VL Janine; last edit: Inga, 10.3.
- protein-protein interaction assay
- lysate + antibody that is coupled to protein A beads
- > binding of antigen
- > pelletizing of antigen
- > washing
- > elution
- > mass-spectrometry analysis
- separating beads from solution: centrifugation at low speed for sepharose beads OR magnet for magnetic beads
What is the yeast two-hybrid system (Y2H)?
VL Janine; last edit: Inga, 10.3.
- protein-protein interaction assay
- works with activation of downstream reporter gene(s) by binding of a transcription factor onto an upstream activation sequence (UAS): TF is split into two separate fragments, the DNA-binding domain (BD, responsible for binding to UAS) and activating domain (AD, responsible for activation of transcription)
- example:
> Gal4 produces two-domain protein (BD and AD) essential for transcription of reporter gene
> 2 fusion proteins are prepared, Gal4BD+Bait and Gal4AD+Prey, and neither of them can initiate transcription alone
> when both fusion proteins are produced AND Bait interacts with Prey, then reporter gene is transcribed
What are protein-protein interactomes?
VL Janine; last edit: Inga, 10.3.
- whole set of molecular and physical interactions among proteins
- Y2H can be used to investigate binary interactions among two proteins at a time
What is crosslinking mass spectrometry?
VL Janine; last edit: Inga, 10.3.
- protein-protein interaction assay
- analyzes interactions that are “locked in place”
- during crosslinking, chemical crosslinkers are used to chemically join components of interacting complexes -> liquid chromatography separation and identification by mass spectrometry analysis
What is protein palmitoylation?
VL Janine; last edit: Inga, 10.3.
- post-translational modification
- covalent attachment of fatty acids (such as palmitic acid) to cysteine residues of proteins
- enhances hydrophobicity of proteins and contributes to their membrane association
- Western blotting to detect palitoylated proteins
- usually reversible
Which genotypes and antibodies were used in the experiment for immunofluorescence staining of the Drosophila NMJ?
What was the aim of the experiment?
(Prakt. Tina; last edit: Inga, 10.3.)
GROUP A) - genotypes: > Ok6-Gal4, UAS:dicer2 x UAS:BRP-RNAi (B3/C8) (III) -> dicer enables downregulation of BRP > Ok6-Gal4, UAS:dicer2 x W1118 (PFA fixation) -> control -> dicer has no effect because there's no RNAi - primary AB: > anti-BRP (Nc82) C-term (m), 1:250 > anti-GluRIID (gp), 1:500 - secondary AB: > Al594 (gp), 1:300 > Al488 (m), 1:500 > HRP-Atto647, 1:250 -> overall staining - aim: > localization of BRP and GluIID > verification of BRP-RNAi > function of BRP regarding synapse assembly and function?
GROUP B) - genotypes: > Cac::sfGFP/X (methanol fixation) - primary AB: > anti-BRP (Nc82) C-term (m) - secondary AB: > anti-mouse Al488 (green) - precoupled primary + secondary AB: > anti-GFP-Nanobody-Atto647, 1:300 -> use with secondaries only - aim: > localization of Ca2+ channel within the synpase > visualizing resolved architecture of BRP ring around Ca2+ channels
We picked male larvae as they can be recognized more easily (testicles). We tried to dissect the same amount of control group animals as experimental group animals for Group A).
Briefly describe the technique of live imaging using a desflurane anesthetization chamber.
(VL Tina; last edit: Inga, 10.3.)
- in vivo imaging with intact Drosophila larvae
- specifically adjusted petri dish with hole; larvae is put on “runway” and covered with cover slip; balanced weight on top, so larvae can’t move around and stretches are where we want to investigate the synapse; larvae gets anesthetized (NMJs would be jumping around otherwise) with desflurane which reduces heart rate to very low level
- > let normal air in -> let desflurane in, so normal air mixes with desflurane -> normal air has to be kicked out
- investigation under confocal microscope
- at NMJs of muscle 26/27
What is axonal transport?
VL Tina; last edit: Inga, 10.3.
- movement of SV, proteins, lipids and mitochondria through the cytoplasm of the axon between the soma and the synapse
- anterograde axonal transport: from soma to synapse; molecules that are needed in the synpase
- retrograde axonal transport: from synapse to soma; “trash”
- slow axonal transport (0.2-2.5mm/day): carries molecules that are not quickly consumend and utilizes axoplasmic flow -> soluble (cytosolic; e.g. glycolytic enzymes)
- fast axonal transport (up to 400mm/day): utilizes kinesins, dyneins and microtubules; actively walks molecules up/down the axon -> SV precursors, mitochondria, AZ proteins (PTVs?)
> microtubules: providing pathway for intracellular movements
> kinesin: from soma to synapse
> dynein: from synapse to soma
-> under consumption of ATP
-> have two head-domains which are alternatingly attached to the MT and bend before the other head attaches (like foot steps) -> steady movement
-> kinesin tail domain appoints the kind of cargo
-> dynein can not directly bind cargo, need dynactin for mediation
-> may also move microtubules themselves
> myosin: takes intermediately what the others can’t take and transports it to synapses; let’s status quo at synapses decide what can go in and what can go back - sushi belt model
What is a kymograph?
VL Tina; last edit: Inga, 10.3.
- axonal transport can be visualized in a kymograph
- x-axis: time
- y-xis: distance
- anterograde transport: from bottom left to top right
- retrograde transport: from top left to bottom right
What is FRAP?
VL Tina; last edit: Inga, 10.3.
FRAP stands for Fluorescence Recovery After Photobleaching and is a technique to measure molecular diffusion and active processes in time. FRAP photobleaching is applied to understand to which extent trafficking vesicles can move between different compartments of cells, the diffusional dynamics and exchange of molecules from one place to another within a cell and to see the speed of response and the amount of cargo carried. Moreover it enables to gain insight into binding and release kinetics of molecules with particular substrates or surfaces to bind.
For FRAP, the region of interest (ROI) is bleached with a laser, removing all fluorescence from this area but not removing the molecules themselves. After time, the fluorescence comes back to the ROI by new molecules diffusing/moving into it. The diffusion coefficient can be determined by measuring the course of fluorescence intensity over time. The later the original fluorescence of the ROI is reached again, the slower is the diffusion of the fluorescing molecule(s).
Molecular kinetics can be fast or slow processes (measured in X = time, Y = distance) and they are visualized in a so-called kymograph.
