Final Flashcards by Elisha Long

Which is the method that does not use copper ions to bind to protein components for estimating proteins?

Bradford Assay

How well did you know this?

Not at all

Perfectly

For measuring bacterial growth, cell density is measured by what principle?

Scattering light at 600nm by the bacterial cells

How well did you know this?

Not at all

Perfectly

What is the concentration of RNA with an A260 of 0.85 using a path length of 0.5 cm?

68.0 micrograms/mL

How well did you know this?

Not at all

Perfectly

The stock solution of fluorescein (molecular weight 332.31 g/mol) is 5 mg/mL. What is the volume of stock solution is needed to make 2 mM solution of fluorescein in a total volume of 3.0 mL?

5g/L * mol/332.31g * x = 2 mM * 1M/10^3 mM * 3 mL= 400 microliters

How well did you know this?

Not at all

Perfectly

The standard curve (absorbance (Y) vs amount in micrograms protein (X)) of Bradford assay for protein BSA is y=0.0536x+0.0026. The absorbance of 10-fold diluted test sample is 0.17, what is the concentration in the starting undiluted sample?

10*.17 = 0.0536 x + 0.0026

X=31.2 micrograms/mL

How well did you know this?

Not at all

Perfectly

The frequency of wave A is 20/s, while that of wave B is 35/s. Which of the waves will have the highest energy?

Wave B

How well did you know this?

Not at all

Perfectly

A 10 mg acetylsalicylic acid (aspirin) dissolved it in 1 mL volume has absorbance (with a 1 cm path length) as 0.1. If the molecular weight of 180.16 g/mol, what is the molar extinction coefficient?

10g/L*mol/180.16 = 0.0555062167 M = C
E = .1/0.0555062167 = 1.8/ (M * cm)

How well did you know this?

Not at all

Perfectly

Which set of the following amino acids are all polar?
FKQ
HMN
DNR
MTE
PCS

DNR

How well did you know this?

Not at all

Perfectly

A amino acid contain two carboxyl groups (pKa of 2.19 and 4.35) and one amino group (pKa 9.8). What is the pI?

3.22

How well did you know this?

Not at all

Perfectly

You have a ten nucleotide (nt) long DNA in a double stranded (ds) form, single stranded (ss) from, and the same ten nucleotides free in the solution. Assume the nucleotides to be composed of three adenine, two guanine, two cytosine, and three Thymine. You determined the absorbance of the DNA and nucleotides at 260 nm. Which of the following represents the absorbance of the different reagents in the order of increasing absorbance?

Ss DNA, ds DNA, free nt
Ds DNA, ss DNA, free nt
Free nt, ds DNA, ss DNA
Ds DNA, free nt, ss DNA
None of the above

Ds DNA, ss DNA, free nt

How well did you know this?

Not at all

Perfectly

What is the overall charge of the peptide GVARGLMPQVNGDKLWQILN at pH 7?

How well did you know this?

Not at all

Perfectly

You have titrated a compound and measured the absorbance, which changes depending on the protonation, versus the pH. You use the linear derivation of the HH and get the following equation for the line. Based on this, what is the pKa?

Log (Aa-Aobs)/(Aobs-Ab)=pH-pKa

Y=0.9177x-6.3555

6.4

How well did you know this?

Not at all

Perfectly

A mixture of the proteins urease (pI 4.0), Beta-lactoglobulin (pI 6.2), and hemoglobin (pI 8.8) need to be purified at pH 7.5 buffer on an anion exchange column. What is the order of elation of the three protein?

Hemoglobin, Beta-lactoglobulin, urease

How well did you know this?

Not at all

Perfectly

In the above question, which among the 3 proteins can elute in the equilibrium buffer without having to increase the salt concentration?

Hemoglobin

How well did you know this?

Not at all

Perfectly

You have carried out a gel filtration purification using a column with a Vo of 12 mL and a Vt of 56 mL. The Kav for the largest protein and the smallest protein are:
Protein Ve
A.            42 mL
B.             18 mL
C.             12.5 mL
D.              31 mL

0.01 for largest; 0.68 for smallest

How well did you know this?

Not at all

Perfectly

The histidine sidechain in an enzyme active site has a pKa of 6.8. About what percent of the histidine side chains are ionized at pH = 6.96?

40%

How well did you know this?

Not at all

Perfectly

How will you prepare 100 mL of a 10% (v/v) solution of Triton detergent from a stock of 50%?

Add 20 mL of 50% Triton and 80 mL water

How well did you know this?

Not at all

Perfectly

Which of the following represents an elation with the most shallow gradient for the choices given?

From 100 mM NaCl to 1 M NaCl in 0 mL
From 100 mM NaCl to .5 M NaCl in 100 mL
From 100 mM NaCl to 1.5 M NaCl in 100 mL
From 100 mM NaCl to 1 M NaCl in 100 mL

From 100 mM NaCl to .5 M NaCl in 100 mL

How well did you know this?

Not at all

Perfectly

The Bradford assay works via what principle?

Coomassie reagent binding all proteins non-specifically

How well did you know this?

Not at all

Perfectly

Which of the following is an amphoteric substance?

A. Carbonic acid
B. Carbonate ion
C. Bicarbonate ion
Both A and B
Both B and C

C. Bicarbonate ion

How well did you know this?

Not at all

Perfectly

Which of the following chromatography methods use isocratic elation to elute the adsorbed material from the column?

Size Exclusion Chromatography
Anion Exchange Chromatography
Cation Exchange Chromatography
None of the above

Size Exclusion Chromatography

How well did you know this?

Not at all

Perfectly

You need to separate a mixture of proteins with the following characters: Protein A: 40 kDa protein that dimerizes in solution, pI of protein A is 6; protein B: 50 kDa, with a pI of 6.5: and protein C: 120 kDa with a pI of 5.6. Choose the best choice from the following options to purify a mixture of these proteins. The component proteins can be separated as a flow through from a column or as elations after binding a column. (The procedure selected should have proteins A, B, and C as finely resolved as possible using the list of choices below.) What is the order of the proteins?

Sephacryl S-200 (fractionation range 5000-250000) order, C, A, B
Sephacryl S-200 (fractionation range 5000-250000) order, C, B, A
Sephardex S-75 (fractionation range 3000-250000) order C, B, A
Anion Exchange column (proteins in Tris buffer pH 7) order C,A, B
Cation Exchange column (proteins in Tris buffer pH 7) order C,B, A

Sepharcryl S-200 order C,A, B

How well did you know this?

Not at all

Perfectly

If a person mixes 70.0 microliters of sample with 1330 microliters of dH2O, then they will have made a ___ fold dilution.

1400/70

How well did you know this?

Not at all

Perfectly

If a person wanted to make a 60 fold dilution of a stock solution into a total volume of 300 microliters, then how many micro liters of stock solution would they require?

5 microliters

300/60

How well did you know this?

Not at all

Perfectly

A protein solution is prepared by dissolving 28.0 mg of protein in 22.0 mL of water. A 0.890 mL sample of this solution is diluted to a volume of 99.0 mL. To two sig figs, how many mg of protein will be in a 3 mL sample of the diluted solution?

28 mg/ 22 mL * 0.890 mL/99 mL * 3 mL =0.03 mg

To three sig figs, how many mg of galactose (MW= 180 g/mol) would you need to make 95 mL of a 48.0 mM solution?

48 mM/1000 mL *95 mL*180 mg/mmol = 821 mg

To three sig figs, how many mL of an 8 M NaCl solution are needed to prepare 87 mL of a 1.97 M NaCl solution?

87 mL * 1.97 M / 8 M = 21.4 mL

The units for molar absorptivity are what?

L / (cm Mol)

You are testing tablets of acetylsalicylic acid (aspirin), which has a molecular weight of 180.16 g/mol. You have developed a colorimetric assay to measure the concentration. You have weighed out 10 mg, dissolved it in 1 mL volume, and measured its absorbance (with a 1 cm path length) as 0.1. What is the molar coefficient?

10 mg / 180.16 (mg/mmol) / mL*1000 mL= 55.5 mM = 0.0555 M E = .1/(0.0555 * 1) = 1.8/( M cm)

UV-Vis, Spectroscopy of organic compounds is usually concerned with which electronic transitions?

Pi to pi* and n to pi*

You are determining the concentration of a protein sample using the Bradford assay. You have a standard curve using the protein lysozyme. The resulting equation for the line is y = 0.0546x + 0.0032. You perform a 1:15 dilution of your sample and measure absorbance at 280 nm. If A280 is 0.65, what is the concentration of the starting undiluted sample?

((.65*15) - .0032)/0.0546 /1000 = .178 micrograms/microliters

Light is passed through a solution with a light path of 2 cm and the absorbance recorded is .40. If light is passed through the same solution at the same wavelength and the light path is reduced to 1cm, the absorbance should be what?

0.20

What does it mean when a gene is said to be cloned directionally?

The inserted gene coding strand is in frame and/or orientation with the vector promoter

Which of the following statements is true about the lac operon? A. The lactose molecule represses transcription by interacting with the LacI protein B. The LacI protein represses transcription unless lactose is present C. The LacO site is found within the coding sequence of each gene D. Glucose can sometimes activate the lac operon by interacting with the lacO site

After running PCR, a researcher loaded an aliquot of the reaction onto an agarose gel. In addition to the expected product, several other larger DNA bands were detected after staining. What is the most reasonable explanation for this result?

The annealing temperature was too low

Cell lysis is carried out by which substance during genomic DNA extraction?

Lysozyme and detergents

DNA polarity (5’ and 3’) arises from what?

The ribose unit

Which enzyme can make a DNA copy using a DNA template?

DNA polymerase

A linear DNA fragment is digested by a restriction enzyme that cuts at two different positions. How many bands will be observed after gel electrophoresis of the digested DNA?

Three

In a Polymerase Chain Reaction (PCR), what is the annealing step?

The step in which the primers will bind to a single stranded DNA

How long is the PCR product with the given primers and the template DNA (positive strand sequence shown)? Primer A 5’ - (CTTC) - 3’ Primer B 5’ - (GGCC) - 3’ Template DNA: 5’ (GGCC)(N100)(CATG)3(N50)(GAAG)(ATTC)4(N100) 3’

170

Design a reverse primer to clone the following sequence into TOPO vector with no c-terminal 6xHis tag in the protein. ATG start codon, TAG stop codon) 5’ ATGCTCGAGTTCGATAACATG(N)200-TTGGCTCAGCTACGTATCGAATAG 3’

Complimentary then reverse of the end TAG ATC CTA

What are restriction enzymes?

Proteins that recognize a specific and generally palindromic DNA sequence

For the pET 101D vector, which ingredient allows for selection such that only positive clones that have taken up the plasmid are able to grow?

Ampicillin

In PCR, the primer annealing temperature is sometimes called the “Goldilocks” temperature. Why?

If it is too high there will be no product, and it if is too low there will be additional non-specific products

BL21 (DE3) cells are essential for protein expression while using TOPO vector due to what?

T7 RNA Polymerase gene inserted into its genome

Which statement is not true about SDS-Page: A. The proteins are denature by heating B. The shape of the protein will affect how far the sample migrates C. The charge is evenly distributed by coating with sodium dodecyl sulfate D. Any disulfide bonds can be reduced or they can be left intact E. The stacking gel must have a different pH than the resolving gel

The shape of the protein will affect how far the sample migrates

If 2.99 mmol/L of NADH was diluted 1:10 and the A340 read in a spectrophotometer, what would be the value of the resulting absorbance using a 1 cm curettes? The molar extinction coefficient of NADH is 6220 (1/(M * cm))

1.86

AdhP converts alcohol to aldehyde by reducing NAD+ to NADH. The extinction coefficient for NADH is 6220 (1/(M*cm)). Based on your Bradford Assay, your AdhP sample is at a concentration of 3.5 mg/mL. You use 0.5 mL of AdhP in a total reaction volume of 1.2 mL and monitor the formation of NADH during the reaction. The rate of change in absorbance at 340 no is 0.9 over 2 minutes using a .5 cm cuvette. What is the activity of the protein in Units.

0.174 units (micromol/min)

Which of the following is true for an SDS Page? A. SDS will covalently modify the protein to separate a protein mixture based on its size B. Reducing agents will act on SDS to improve the ability of SDS to denature protein molecules C. The changes in the net charge of glycinate ions along the different layers of an SDS Page gel is important for carrying the proteins along the gel D. The pH of the separating/resolving gel is 6.8, while that of the stacking gel is 8.8 E. The smaller pores of the stacking gel are essential for stacking the proteins on the top of separating/resolving gel

What is the temperature profile for amplifying a DNA fragment using PCR ?

Denaturation, annealing, extension

What is LacI?

A repressor protein that binds a specific sequence called an operator

When purifying genomic DNA, the first ingredient added to the overnight culture of E.coli K-12 cells is Tide detergent. What is the purpose of Tide?

To lyse the cells

The presence of a selectable marker on the plasmid allows the researchers to determine what?

If the bacterial cell has taken up the plasmid

The Bradford assay works via what principle?

Coomassie reagent binding all proteins non-specifically

What is a method of cloning that can never be directional?

Blunt-ended

What is the reason you want to use directional cloning?

To ensure that the gene of interest will be transcribed in a forward reading frame

A Western blot with using an antibody specific to your protein of interest can tell you what?

What size your protein of interest is

What is the purpose of 70% ethanol wash used during genomic DNA preparation?

The 30% water helps de-salt the sample

What is an epitope?

A section on an antigen that is recognized by an antibody

During genomic DNA isolation, addition of what makes DNA precipitate? Why does the DNA precipitate?

Iso-propanol because it makes DNA insoluble and the DNA drops out of the solution

What is the normal extension temperature of a Polymerase Chain Reaction? How much time does it take the strands to extend?

52-65 C 1 min for every 1k base pairs

Which cycle of the PCR reaction do you end up with a product that only spans between the primers for the first time? In the 10th cycle of the PCR reaction, how many total DNA strands will you have and how many will have the size that spans between the primers?

Third Total = 2^10 = 1024 Span between primers= 2^10 - (2*10) = 1004

Explain the purpose of the blocking step in Western-blot. What reagent is used in the lab for blocking?

Blocking prevents the antibodies from non specifically binding to the membrane. Milk powder is used.

Why can we not use SDS in isoelectric focusing gels?

IEF gels run as per the pI of the protein and SDS gives a uniform negative charge to all the proteins.

What does the Michaelis-Menten model assume?

Enzyme, substrate, and enzyme-substrate complex are in equilibrium

Given an enzyme with a Km of 0.5 mM and Vmax = 200 mmol/s, at what substrate concentration will the velocity of the enzyme reach 1/4 of the Vmax?

V = 200/4=50 50 = (200 * S)/(0.5 + S) S = 0.17 mM

Functions of enzymes include all of the following except A. Shifting substrates into more favorable positions in the active site B. Catalyzing both forward and reverse reactions C. Lessening the time required for a reaction to take place D. Shifting the equilibrium of a reaction

Which of the following would most greatly increase the activity of an enzyme functioning in the small intestine? A. Decrease the pH B. Increase the amount of enzyme C. Increase the amount of substrate D. Decrease the temperature

C. Increase the amount of substrate

Which of the following statements about enzymes is false? A. The Keq of a reaction remains unchanged in the presence of an enzyme B. Enzymes speed up the rate of reaction in DNA synthesis C. Harsh, acidic conditions can completely denature an enzyme D. An enzyme is completely converted to product during metabolism.

D. An enzyme is completely converted to product during metabolism

In order to catalyze a reaction, an enzyme is required to what?

Decrease the activation energy

Which of the following is false concerning enzymes? A. Enzymes reduce reaction activation energy B. Enzymes increase the amount of product created in a reaction C. Enzymes increase both the forward rate and reverse rate of a reaction D. Substrates must bind the enzyme’s active site in order to initiate its effects E. Enzymes are not destroyed in a reaction and can be used in the same reaction countless times

B. Enzymes increase the amount of product created in a reaction

Which of the following are true about the Michaelis constant for any given enzyme? A. It is equal to Vmax/2 B. It is independent of the type of substrate C. None of the answers are true D. It increases as the enzyme’s specificity for the substrate decreases E. It increases as the enzyme’s affinity for the substrate decreases

D and E

Which of the following is false about the Michaelis-Menten equation? A. Velocity is inversely proportional to enzyme concentration B. Velocity is proportional to the turnover number C. Velocity is proportional to the substrate concentration D. Velocity is proportional to the enzyme concentration E. The maximum rate of the reaction is reached as the substrate concentration increases indefinitely.

A. Velocity is inversely proportional to the enzyme concentration

Which of the following is a correct statement with regards to an enzyme-catalyzes reaction that obeys Michaelis-Menten kinetics? A. The reaction is first order with respect to substrate at low substrate concentrations, and zero order with respect to substrate at higher substrate concentrations B. None of these C. The reaction is always zero-order with respect to substrate regardless of substrate concentration D. The reaction is always first-order with respect to substrate regardless of substrate concentration E. The reaction is first-order with respect to substrate at high substrate concentrations, and zero-order with respect to substrate at lower substrate concentrations.

A mixed inhibitor was found to bind unequally to an enzyme and its enzyme-substrate complex. It has a ki of 6 mM for the enzyme, and a Ki of 2mM for the enzyme-substrate complex. If the inhibitor decreased Vmax by a factor of 3, what concentration of inhibitor was used?

4 mM 3=1+([I]/K’i)

A student is conducting an experiment in which he adds an inhibitor to an enzyme catalyzed reaction. When the student first adds the inhibitor, the reaction rate decreases, however, he can return the reaction rate to normal by adding a large quantity of substrate. What type of inhibitor is the student using?

A competitive inhibitor

What type of inhibition affects both the Michaelis constant and the maximum reaction rate of an enzyme?

Non-competitive inhibition mixed and uncompetitive inhibition

Match the type of inhibition with the appropriate change in either Vmax or Km ``` A. Uncompetitive; decrease in Km B. Mixed; increase in Vmax C. Competitive; decrease in Km D. Uncompetitive; unchanged Vmax E. Competitive; decrease in Vmax ```

Pepstatin binds to the enzyme pepsin. The substrate is still able to bind to the active site, but the reaction is blocked. What is this an example of?

Non competitive inhibition

Diisopropylflourophosphate (DFP) is an example of an enzyme inhibitor. It covalently binds to a serine residue in the active site of a serine protease, thus inactivating the enzyme. Based on this information, what type of enzyme inhibitor is DFP?

Irreversible

Which of the following is true regarding noncompetitive inhibition? A. Noncompetitive inhibition decreases the affinity of the enzyme to the substrate B. Substrate can never bind to the enzyme in the presence of a noncompetitive inhibitor C. Noncompetitive inhibition decreases the maximum efficacy of the enzyme D. More than one of these is true

Which of the following changes occurs when an uncompetitive inhibitor binds to the enzyme-substrate complex? ``` A. Km increases B. Km remains unchanged C. Vmax remains unchanged D. Km decreases E. Vmax increases ```

Sulfanilamide is an antibiotic that resembles the intermediate, 4-aminobenzoic acid (PABA), in the metabolic pathway to create folic acid. It binds to the active site of the enzyme that normally binds to PABA and inhibits the binding of PABA temporarily. Since folic acid is necessary for bacterial growth, this antibiotic helps inhibit the spread of infection in humans. Based on this information, what type of inhibitor is sulfanilamide?

Competitive

Which of the following is true about pure noncompetitive inhibition? A. Vmax stays the same however, Km increases B. Vmax changes however, Km does not change C. The inhibitor binds to a separate site from the substrate and enhances enzyme activity D. The inhibitor competes with the substrate to bind to the active site, and drops the Vmax E. The inhibitor binds to the same site as the substrate, dropping the Km