EXAM 4 Flashcards
DNA is more resistant to hydrolysis than RNA.
What feature of DNA is responsible for this characteristic?
the absence of a 2′‑hydroxyl group in deoxyribose
The difference between a nucleoside and a nucleotide is that
nucleotides contain one or more phosphate groups, whereas nucleosides have none.
The major interaction stabilizing the double helical structure of DNA is
hydrogen bonds between bases on opposite strands.
An important key to understanding the structure and function of DNA was the observation that the amount of A equaled the amount of T and the amount of G equaled the amount of C.
Erwin Chargaff
Which compound is found in DNA but not in RNA?
thymine
Write the complementary sequence for TCGAAC. Write the new sequence in the standard 5′→3′ notation.
5’ GTTCGA 3’
Biochemist Erwin Chargaff was the first to discover that, in DNA, [A]=[T] and [G]=[C]. These equalities are now known as Chargaff’s rule.
Using Chargaff’s rule, determine the percentages of all of the bases in DNA that is 14% thymine.
Adenine =14%
Cytosine =36%
Guanine =36%
How many hydrogen bonds exist between this DNA strand and its complementary strand?
A:T = 2
G:C = 3
The composition, in mole‑fraction units, of one of the strands of a double helical DNA molecule is [A]=0.30 and [G]=0.24. This strand is the reference strand.
What is the total [T] and [C] for the reference strand?
[T+C] R: 0.46
[A+G] C: 0.46
[T] C: 0.3
[C] C: 0.24
Bacteria and other microbes can be used to “clean up” an oil spill by breaking down oil into carbon dioxide and water. Two samples isolated from the Deepwater Horizon leak in the Gulf of Mexico were labeled A and B. The DNA of each was isolated and the percent thymine measured in each sample. Sample A contains 17.7 % thymine and sample B contains 28.9 % thymine. Assume the organisms contain normal double‑stranded DNA and predict the composition of the other bases.
percent adenine in sample A:
17.7%A
percent guanine in sample A:
32.3%G
percent cytosine in sample A:
32.3%C
percent adenine in sample B:
28.9%A
percent guanine in sample B:
21.1%G
percent cytosine in sample B:
21.1%C
How is circular DNA compacted within the nucleoid of a cell?
supercoiling
What is the term for two circular DNA molecules that differ only in the number of helical turns, also called linking number?
topoisomerS
Which factor accounts for the increased rate of DNA synthesis necessary for replication in eukaryotic cells as compared to that in prokaryotes?
the presence of multiple origins at which replication can take place at the same time
During the replication of DNA,
one strand is synthesized continuously and the other is synthesized in short segments.
DNA replication in E. coli begins at a unique site called the
origin of replication
Arrange the steps of DNA replication in the order that they occur.
FIRST STEP
helicase unwinds the DNA double helix
single-stranded DNA binding proteins bind to each template strand
RNA primers are added
DNA polymerase synthesizes DNA
RNA primers are removed
DNA ligase joins DNA fragments together
LAST STEP
DNA replication involves multiple steps that require different enzymes. Which process does primase catalyze in DNA replication?
Synthesis of a short RNA sequence that initiates DNA synthesis
Match each protein to its role in DNA replication
DNA topoisiomerase: relaxes the supercoiled DNA
helicase: unwinds the DNA double helix
SSB protein: prevents the reannealing of the DNA strands
DNA polymerase I: replaces the RNA primers with DNA
primase: synthesizes RNA primers
As DNA is replicated, both continuous and discontinuous replication occur. Discontinuous replication is the result of which specific feature of DNA?
antiparallel strands
Identify each characteristic as belonging to the leading strand or the lagging strand in DNA synthesis.
Leading strand: synthesized continuously, 5’»3’
Lagging strand: Okazaki fragments, 3’»5’, forms loo[s during replication
One of the biologically harmful effects of ultraviolet (UV) light is its action on DNA.
How does UV light alter DNA?
covalent formation of pyrimidine dimers involving adjacent pyrimidines along a DNA strand
If a DNA molecule is damaged, it
is possible to repair the damage in the site where it occurs.
Which process is NOT a possible type of damage to DNA?
formation of more than three hydrogen bonds in a Watson–Crick base pair
What generally causes thymine dimers to form in a strand of DNA, and why are thymine dimers a problem?
Ultraviolet light can cause thymine dimers, potentially creating a mutation that could lead to cancer.
What strategies do cells use to ensure that newly replicated DNA does not contain errors?
Enzymes proofread the DNA after the DNA has been replicated and replace any mismatched nucleotides.
Enzymes find misshapen DNA sequences prior to replication and remove and resynthesize those sequences.
As DNA polymerase synthesizes new DNA, the DNA polymerase finds and corrects misplaced nucleotides.
Place the steps of nucleotide excision repair in order. Not all the choices will be used.
recognize damaged site
remove DNA section using ABC excinuclease
close DNA ends with DNA ligase
Select the repair mechanisms that are responsible for maintaining the integrity of DNA
DNA recombination
proofreading by DNA polymerase
direct repair
Match the repair system with the type of damage it can repair
base excision repair
nonhomologous end joining
mismatch repair
base excision repair: a damaged nucleotide
nonhomologous end joining: a double-stranded break
mismatch repair: a G to C substitution
Which factor is similar between DNA and RNA synthesis?
the direction of synthesis
During transcription, separation of the DNA strands is necessary.
This separation involves
separation in only a small segment of DNA at a time.
In E. coli, the lac operon is turned on by a derivative of lactose (allolactose) binding to
a regulatory protein bound to the operator of the lac operon, which permits transcription by causing the release of this allolactose‑regulatory protein complex from the lac operator.
According to the central dogma, double-stranded DNA serves as the template for the production of RNA during transcription.
Which of the two DNA strands serves as the template for transcription?
Either DNA strand may be used as a template by RNA polymerase, but a single DNA strand oriented in the 3’–5’ direction is used as a template each time transcription occurs.
Categorize the differences between the coding strand and the template strand in DNA.
CODING: same sequence as that of RNA transcript, except for T in place of U
sense strand
strand that is not transcribed
TEMPLATE: sequence complementary to RNA transcript
antisense strand
transcribed
5’————————-3’
A. B. C.
3’————————-5’
Gene transcription occurs from right to left for gene A and gene B, whereas transcription occurs from left to right for gene C, as in the diagram.
Therefore, the template strand for gene A is the
top
strand, the template strand for gene B is the
top
strand, and the template strand for gene C is the
bottom
strand.
The sequence of part of an mRNA transcript is
5′−AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG−3′
What is the sequence of the DNA coding strand?
What is the sequence of the DNA template strand?
5’ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGA3’
5’CTCCTTGGACAGGGCCCCACTCTTGCTGTTCCCCAT3’
Many molecules, including transcription factors, work together to transcribe genes and translate the information taken from the genes into proteins.
What is a transcription factor?
a protein that binds to a specific DNA sequence to regulate transcription
Which mRNA sequences would form a structure that is a cue for transcription termination of some genes?
a palindromic GC‑rich region followed by a sequence of uracil residues in the RNA
5′−GCAUCUUACUGAUGCUUUU−3′
Arrange the stages of RNA synthesis in the order in which they occur.
FIRST
initiation
elongation
termination
LAST
Some regulatory proteins interact with other proteins or DNA sequences to increase or decrease the rate of transcription of a gene.
For each regulator, determine which phrase describes its function, and then determine which are proteins.
OPERATOR: often near promoter, may interact with the proteins to suppress transcription
ACTIVATION: bind to a regulatory site on DNA increasing the gene transcription rate
REPRESSOR:binds to a regulatory site on DNA decreasing the gene transcription rate
What is the function of the repressor in the E. coli lac operon?
The repressor is a protein that prevents the transcription of the lactose genes by binding to the beginning of the lac operon.
Determine which events will increase the concentration of lac gene products and which will decrease the concentration of lac gene products.
Increase in gene products: the I gene is disabled
Lactose is p[resent in the cell
Allolactose binds to the Lac repressor protein
the Lac repressor dissociates from DNA
Decrease in gene products: Allolactose is not present in the cell
the Lac repressor remains bound to the operator
Predict the effect of deleting the gene encoding the lac repressor.
Predict the effect of deleting the lac operator.
Predict the effect of deleting the gene encoding catabolite activating protein, CAP.
Cells will express β‑galactosidase, permease, and thiogalactoside transacetylase in the absence of lactose.
Cells will express β‑galactosidase, permease, and thiogalactoside transacetylase in the absence of lactose.
The levels of β‑galactosidase will be low at low levels of glucose.
Which eukaryotic promoter elements are recognized by RNA polymerase III?
A block and C block
Gene regulation in eukaryotes is much more complex than in prokaryotes.
Which statement does NOT help explain this difference in gene regulation complexity?
The genetic code differs significantly between prokaryotes and eukaryotes.
In eukaryotes, DNA is present in a chromatin structure.
Chromatin is made up of DNA that is
highly ordered by wrapping around histones.
Gene regulation in eukaryotes involves reorganization of the chromatin structure such that DNA binding is weakened in regions to be transcribed.
chemical modification of histone proteins.
Which statement does NOT help explain the differences between gene transcription in eukaryotes and prokaryotes?
Most eukaryotes have regulatory sites that are close to their promoters.
Which statement does NOT help explain the differences between gene transcription in eukaryotes and prokaryotes?
Most eukaryotes have regulatory sites that are close to their promoters.
Match the chracteristics of transcription to eukaryotes and bacteria
EUKARYOTES: three distinct RNA polymerases
more than three promoter elements
extensive pre-mRNA processing
occurs in the nucleus
BACTERIA: one RNA polymerase
three promoter elements
little pre-mRNA processing
coupled transcription and translation
Match each property with the appropriate RNA polymerase.
RNA POLYMERASE I: insensitive to a-amanitin
located in the nucleolus
synthesizes 18S, 5.8S AND 28S rRNA
RNA POLYMERASE II: synthesizes mRNA precursors
phosphorylated YSPTSPS repeats
binds to TATA box containing promoters
very sensitive to a-amanitin
synthesizes snRNA
RNA POLYMERASE III: synthesizes tRNA
moderately sensitive to a-amanitin
Identify the statements that are features of a promoter.
In prokaryotes, the promoter contains a –35 and –10 region upstream of the transcription start site.
In eukaryotes, the promoter often contains a TATA box, which is where the TATA‑binding protein binds.
In both prokaryotes and eukaryotes, the promoter is located in the 5′ direction, upstream from the transcription start site.
Do the phrases describe prokaryotic promoters, eukaryotic promoters, or both?
PROKARYOTIC: recognized by the sigma factor of RNA polymerase
includes two conserved sequences at -35 and -10
EUKARYOTIC : requires multiple proteins called general transcription factor
may include a TATA box upstream of the transcription start site
BOTH: contains highly conserved DNA sequence
Classify the characteristics of eukaroytic cis‑acting and trans‑acting elements.
CIS: regulated gene on same DNA molecule
noncoding DNA
TRANS: transcription factors
regulated gene on different DNA molecule
In eukaryotes, transcription factors and enhancer sequences are used to regulate transcription. Classify the statements as true or false.
TRUE : transcription factors are composed of amino acids
enhancer sequences can be located thousands of base pairs downstream from the transcription start site
FALSE: enhancer sequences directly alter the transcription levels
transcription factors bind to the entire enhancer sequences
transcription factors always decrease transcription levels
Many eukaryotic genes are divided into mosaics of exons and introns with only the exon portions containing the coding sequence for a protein.
The introns are transcribed and spliced out before translation.
Which process is NOT seen in the editing of RNA in eukaryotes?
adding a poly(A) tail to the 5′ end
In contrast to prokaryotes, eukaryotes have multiple RNA polymerases.
Which eukaryotic RNA polymerase is involved in the synthesis of pre‑mRNAs?
RNA polymerase I
The removal of introns during splicing is catalyzed by
RNA molecules associated with the spliceosomes.
The three rRNA components of the 60S large ribosomal subunit (28S, 5.8S, and 5S) are obtained from
transcription by RNA polymerase I and RNA polymerase III.
What is the function of the spliceosome?
The spliceosome removes the introns and joins the exons to form the mature transcript.
5’ [TTGTGCGGATAG]{GTCCTaTTTAAC} 3’ []=EXON {}=INTRON
What is the outcome of this mutation with regard to the ultimate protein that will form from this sequence?
Nothing. This mutation does not affect a coding region. The protein will be unchanged.
Identify the reason for considering the one gene, one enzyme hypothesis as an oversimplification.
Alternative splicing allows the formation of more than one protein from a gene.
The genetic code is said to be degenerate because
more than one codon may code for a specific amino acid.
One benefit of the degeneracy of the genetic code is that
it lessens the chance of deleterious mutations.
The translation process reads the mRNA in the _____ direction and synthesizes the protein in the _____ direction.
5′‑to‑3′; amino‑to‑carboxyl
During attachment of an amino acid to its tRNA, how is ATP required?
The ATP forms an aminoacyl adenylate that transfers the activated amino acid to the tRNA.
The codon AUG specifies either initiation of protein synthesis or an internal methionine.
What would be the sequence of the anticodon of a tRNA that binds to this codon?
5′‑CAU‑3′
Which statement is NOT true of tRNA?
tRNA contains a codon.
Choose which characteristics are key features of the genetic code.
Three nucleotides encode an amino acid.
The code has directionality.
The code is degenerate.
Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence
5′−ATTACAGGCGGT−3′
Write the amino acid sequence encoded by the mRNA base sequence
5′−GAGUUAGUUUGUAAGUGC−3′
What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell‑free protein‑synthesizing system that does not require a start codon?
ACCGCCUGUAAU
glu-leu-val-cys-lys-cys
Leu-Leu-Thr-Tyr
Select all the reaction steps required to form an aminoacyl‑tRNA.
formation of an aminoacyl adenylate from an amino acid and ATP
transfer of an aminoacyl group to a tRNA molecule
The role of the RNA‑induced silencing complex (RISC) in RNA interference is to
disrupt gene expression by cleaving mRNAs that are complementary to the guide strand of the RNA duplex that was introduced.
During ribosomal protein synthesis, the growing peptide chain moves from the tRNA in the ____ site to the aminoacyl tRNA in the ____ site.
P; A
Termination of protein synthesis occurs when a stop or termination codon is in the A site.
Termination occurs because
stop codons are recognized by specific proteins that release the newly synthesized protein chain from the ribosome
Which statement is true of the tRNA‑binding sites of the ribosome?
The A site is closer to the 3′ end of the mRNA molecule being translated than the P site.
The
binds the tRNA molecule that is attached to the growing peptide chain.
The site that binds the aminoacyl-tRNA is the
.
The
may be bound to deacylated (uncharged) tRNA.
The site that binds the peptidyl-tRNA is the
The
P site
binds the tRNA molecule that is attached to the growing peptide chain.
The site that binds the aminoacyl-tRNA is the
A site
.
The
E site
may be bound to deacylated (uncharged) tRNA.
The site that binds the peptidyl-tRNA is the
P site
.
Which of the events occur during eukaryotic translation initiation?
The small ribosomal subunit binds with a specific tRNA to the mRNA and scans for a start codon.
Which of the events occur during eukaryotic translation elongation?
A tRNA binds a codon and the ribosome adds amino acids from each tRNA to the polypeptide chain
Which event occurs during eukaryotic translation termination?
The ribosome dissociates from the mRNA after the stop codon is recognized by a protein.
Both prokaryotes and eukaryotes use the information encoded on the genes in their DNA to synthesize proteins. How does the process of translation in prokaryotes differ from translation in eukaryotes?
PROKARYOTIC: Translation can begin as soon as the 5’ end of the mRNA is free of the DNA
Only free-floating ribosomes in the cytoplasm are involved
The entire RNA transcript is used without any modifications
EUKARYOTIC: Introns are removed from the pre-mRNA before ribosomes can use the mRNA
Mature mRNA has a cap on one end and a poly-A tail on the other
Ribosomes are located both in the cytoplasm and attached to the endoplasmic reticulum
Put the steps of the membrane translocation of eukaryotic secretory proteins in order, starting after the signal peptide emerges from the ribosome and ending with the protein being transported by vesicles out of the endoplasmic reticiulum.
THE SIGNAL PEPTIDE EXITS THE RIBOSOME DURING TRANSLATION
SRP bind to the signal peptide and translation stops
SRP moves the ribosome to the ER membrane
Ribosome docks to a translocon
Translation resumes
The growing polypeptide crosses the ER membrane through translocon
Signal peptidase removes the signal peptide from the growing polypeptide
The remainder of the polypeptide is moved into the ER lumen
PROTEIN IS TRANSPORTED OUT OF THE ER
