DNA Replication, Translation & Transcription

Question 1

What is a Nucleotide?

Answer 1

basic building block of nucleic acids (DNA or RNA)
— provide genetic instruction for organisms

Keynote: DNA is the genetic material found in all living organisms

Question 2

What are the Components of a Nucleotide?

Answer 2

Each nucleotide has:
- a base (example: nitrogenous base)
- a phosphate
- a pentose (5 sided) sugar (with 5 carbons)
nucleotides in a strand

( DNA or RNA are linked together by covalent bonds between
the pentose sugar of one nucleotide and the phosphate of„
the next one)

Question 3

What are Nucleic acids?

Answer 3

Long chains of nucleotides which store and transmit genetic information

The two main types of nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)

Question 4

Differences between DNA & RNA

Answer 4

DNA:
1. Has deoxyribose sugar
2. Bases present are (A)(T)(G)(C)
3. DNA is doubled stranded (has 2 strands)
(Strands are antiparallel – run in opposite direction — in 3’ to 5’ direction)
(Strands are linked to each other by hydrogen bonding between Complementary base pairing)
==========================================================
RNA:
1. Has ribose sugar
2. Bases present are (A)(U)(G)(C)
3. RNA is single stranded (has 1 strand)

(Complementary base pairing — bases that can pair up)
In DNA:
(A) pairs with (G) & (C) with (G)

(Complementary base pairing linked by hydrogen bonds creates
specific sequences of bases)

Question 5

How was DNA discovered?

Answer 5

Phoebus Levene, 1919, found:
DNA is composed of nucleotides made up of sugar, phosphate, and base

Erwin Chargaff, 1950, found
DNA is composed of an equal number of purines (A + G) and pyrimidines (C + T)

Crick and Watson. 1953:
accurately modeling the structure of DNA
(Found DNA has double helix)

although Rosalin Franklin also contributed but gets overshadowed (she created an X-ray crystallography that showed double helix structure of DNA which Crick & Watson used to build the model)

Question 6

What are the two big a Categories for Nitrogenous bases?

Answer 6

First Group:
purines — have a double ring structure
Include: (Adenine (A) and Guanine (G)

Second Group:
Pyrimidines —- have a single ring structure
Include: (Cytosine (C) Uracil (U) and Thymine (T)

Question 7

Define Double Helix?

Answer 7

two complementary strands of nucleotides attached to each other. by bases and held together by hydrogen bonds

Question 8

Types of Nitrogenous Bases

Answer 8

Nitrogenous base: A molecule that contains nitrogen and has the chemical properties of a base

nitrogenous bases in DNA are adenine (A), guanine (G), thymine (T), and cytosine (C)

nitrogenous bases in RNA are adenine (A), guanine (G), uracil (U), and cytosine (C)

Question 9

How does genetic information change?

Answer 9

Mutations

Example: Mutation could cause a change in DNA that arises at regular intervals

Consequences
Could also lead to variety within a species —– leading to evolution

Question 10

What is a nucleosome

Answer 10

DNA wrapped around 8 histone protein held together by a 9th histone

Question 11

Explain Semi Conservative Replication

Answer 11

Semi Conservative replication (The accurate one)
two strands of DNA separate due to breaking of hydrogen bonds. New polymers of nucleotides are formed on each of the two strands.
Keynote:A strand of DNA on which a new strand is formed is called a template strand. This occurs because each nitrogenous base can only pair with its complementary partner:
Adenine (A) pairs with thymine (T)
Cytosine (C) pairs with guanine (G)
Due to complementary base pairing, each of the new strands will have the same base sequence as the old parent strand that was separated from the template strand. Thus, this type of replication results in two molecules being produced, one new strand and one old strand each of DNA molecules

Simple version
2 strands open up, each strand makes a new strand. The two molecules at the end are one new strand. and one old strand

Question 12

Explain Conservative & Dispersive Replication

(Incorrect ones)

Answer 12

Conservative —- 2 strands of parent DNA remain together and form two new strands. The new strands went together and the old strands went together

Dispersive —- 2 strands opened up. Segments of the new and old strands were made together to form one strand

Question 13

Explain Meselson and Stahl’s Experiment (1958)

Answer 13

cultured E. coli bacteria in a medium where the only nitrogen source
was Nitrogen 15. So the nitrogen in the bases of the bacterial DNA was Nitrogen 15. They then transferred the bacteria abruptly to a medium with the less dense Nitrogen 14 isotope. Meselson and Stahl spun samples of DNA collected from their bacterial culture at different times in an ultracentrifuge after transfer to Nitrogen 14 medium. After one generation the. DNA was intermediate in density between Nitrogen 14 and Nitrogen 15, disproving the conservative model. After two generations there were two equal bands, one still Nitrogen 14/15 and one at Nitrogen 14 density, disproving the dispersive model. Meselson and Stahl demonstrated that DNA replicated semi-conservatively, meaning that each strand in a DNA molecule serves as a template for the creation of a new strand.

Question 14

Explain the process of DNA Replication

Detail

Answer 14

DNA replication is a semi-conservative process whereby pre-existing strands act as templates for newly synthesized strands
The process of DNA replication is coordinated by two key enzymes – helicase and DNA polymerase. DNA Helicase unwinds the double helix and separates the two strands by breaking hydrogen bonds. DNA polymerase links nucleotides together to form new strands in a. 3’ to 5’ direction, using the pre-existing strands as templates. One strand doesn’t form continuously but forms Okazaki fragments that connect to each other. These fragments later form one continuous strand through an enzyme catalyst. The daughter DNA molecules each rewind (coil) into a double helix in a semi-conservative fashion with each new double helix having an old and new strand. The two daughter DNA molecules are identical in base sequence to each
other and to the parent molecule, because of complementary
base pairing. Adenine will only pair with thymine and cytosine will only pair with guanine. Each of the new strands is complementary to the template strand on which it was made and identical to the other template strand

Question 15

Explain the process of DNA Replication

In Brief & touch on its significance

Answer 15

DNA replication is the process by which the DNA molecule is copied to produce two identical DNA strands. Replication is tightly controlled by enzymes. The enzymes also proofread the DNA during replication to correct any mistakes. DNA replication is required before mitosis can occur. After replication, the chromosome is made up of two chromatids. Each chromatid contains half original and half new DNA. The chromatids separate during mitosis.

Question 16

Define Transcription

Answer 16

The process by which DNA makes messenger RNA (mRNA)
(Happens in G1 of the cell cycle)

mRNA is made in nucleus —- mRNA is used to make protein

Question 17

Explain the process of Transcription

in detail

Answer 17

RNA polymerase separates the DNA strands and creates a complementary RNA copy from one of the DNA strands. RNA nucleotides are assembled along one of the two strands of DNA in a 5’ to 3’ direction. The same rules of complementary base pairing are followed as in replication, except that uracil pairs with adenine, as RNA does not contain thymine. The RNA nucleotides are linked together by covalent bonds. Once the RNA sequence has been created, RNA polymerase detaches from the DNA molecule and the double helix reforms

Key note:
The strand that is transcribed is called the antisense strand and is complementary to the RNA sequence . The strand that is not transcribed is called the sense strand and is identical to the RNA sequence (with T instead of U)

Transcription of genes occur in the nucleus (where DNA is), before the RNA moves to the cytoplasm (for translation)

Question 18

Define Translation

Answer 18

Production of protein by mRNA and tRNA.
(due to mRNA strand interacting with ribosome)

When mRNA arrives in the cytoplasm it can :
1) cause the formation of ribosomes around it
(free-floating ribosomes – which are made for use within the cell)

2) go to ribosomes fixed on the edoplasmic recticulum (RER) and synthesize proteins used for export/secretion)

Question 19

Explain process of Translation

in detail

Answer 19

Messenger RNA containing a series of codons consisting of three bases binds to a site on the small subunit of the ribosome were each of which codes for one amino acid. Ribosomes bind to mRNA in the cytoplasm and move along the molecule in a 5’ – 3’ direction until it reaches a start codon (AUG). With transfer RNA molecules present around the ribosome in large numbers, each tRNA has a special triplet of bases called an anticodon and carries the amino acid corresponding to this anticodon. There are three binding sites for tRNA molecules on the large sub-unit of the ribosome but only two ever bind at once. A tRNA can only bind if it has the anticodon that is complementary to the codon on the mRNA. The bases on the codon and anticodon link together by forming hydrogen bonds, following the same rules of complementary base pairing as in replication and transcription.
The amino acids carried by the tRNA molecules are bonded together by a peptide linkage. The ribosome moves along the mRNA to the next codon. Another tRNA carrying an amino acid binds. A chain of three amino acids is formed. These stages are repeated until a polypeptide is formed.

Question 20

Define a codon & a triplet code

Answer 20

1) A codon – A group of three bases

2) a triplet code — three bases code for one amino acid

Question 21

Define an mRNA triplet codon, an anticodon, a start codon and a stop codon

Answer 21

1) mRNA triplet codon — three bases code for RNA
2) Anticodon — three bases code for tRNA
3) Start codon – three bases code that starts the process of translation (e.g AUG)
4) Stop codon — causes three bases code polypeptide chain to stop (e.g UAA/UAG & UGA)

Question 22

Distinguish between a promoter and terminator region

Answer 22

Promoter region — gets transcription started

Terminator regions – ends the process of transcription

Question 23

With respect to codon, illustrate degeneracy of the genetic code

Answer 23

DNA undergoes a mutation that changed one of the bases of the DNA strand and it was still coded. Thus, you will have multiple codons for one amino acid due to the mutation of DNA

Question 24

Define gene expression

Answer 24

Process of rewriting a gene into a protein. It involves the transcription of DNA into mRNA and the translation of mRNA into protein

Question 25

State the function of RNA polymerase & DNA polymerase

Answer 25

DNA polymerase synthesizes new strands from the two parental template strands

RNA polymerase separates the DNA strands and synthesizes a complementary RNA copy from one of the DNA strands

Question 26

Define the term genetic code & why it is universal

Answer 26

The genetic code is the set of rules by which information encoded within mRNA sequences is converted into amino acid sequences (polypeptides) by living cells. The genetic code is a triplet code (three bases code for one amino acid)

The genetic code is universal – almost every living organism uses the same code (there are a few rare and minor exceptions)

As the same codons code for the same amino acids in all living things, genetic information is transferrable between species

Question 27

Explain how to convert a sequence from mRNA to DNA & illustrate an example

Answer 27

For converting a sequence from mRNA to the original DNA code, apply the rules of complementary base pairing:

Cytosine (C) is replaced with Guanine (G) – and vice versa
Uracil (U) is replaced by Adenine (A)
Adenine (A) is replaced by Thymine (T)

Example: (mRNA) AUG CCA GUG ACU UCA GGG ACG AAU GAC UUA

Answer: (DNA) TAC GGT CAC TGA AGT CCC TGC TTA CTG AAT

Question 28

Explain how to covert a sequence from mRNA into a polypeptide chain (amino acid) & illustrate an example (use a table of amino acids)

Answer 28

The mRNA transcript is organised into triplets of bases called codons, and as such three different reading frames exists

An open reading frame starts with AUG and will continue in triplets to a termination codon
A blocked reading frame may be frequently interrupted by termination codons

Once the start codon (AUG) has been located and reading frame established, the corresponding amino acid sequence can be deduced using the genetic code

Example: (mRNA) GUAUGCACGUGACUUUCCUCAUGAGCUGAU

Answer: (codons)
GU AUG CAC GUG ACU UUC CUC AUG AGC UGA U

Answer: (amino acid)
Met His Val Thr Phe Leu Met Ser STOP

Question 29

Explain how the transfer of genes between species relates to the production of human insulin in bacteria

Answer 29

The amino acid sequence of the insulin that is produced in these organisms using the transferred gene is identical to the sequence produced in humans. This is because of the
universality of the genetic code. E. coli and humans use the same genetic code so each codon in the mRNA is translated
into the same amino acid when insulin is made. Human insulin is a protein that contains just 51 amino acids. The gene responsible for insulin production can be extracted from a human cell
It is spliced into a plasmid vector (for autonomous replication and expression) before being inserted into a bacterial cell
The transgenic bacteria (typically E. coli) are then selected and cultured in a fermentation tank (to increase bacterial numbers)
The bacteria now produce human insulin, which is harvested, purified, and packaged for human use (i.e. by diabetics).

Question 30

Describe the polymerase chain reaction (PCR)

Answer 30

The polymerase chain reaction (PCR) is an artificial method of replicating DNA under laboratory conditions

The PCR technique is used to amplify large quantities of a specific sequence of DNA from an initial minute sample
Each reaction doubles the amount of DNA – a standard PCR sequence of 30 cycles creates over 1 billion copies (230)

Question 31

Explain the process that occurs in polymerase chain reaction (PCR)

Answer 31

The reaction occurs in a thermal cycler and uses variations in temperature to control the replication process via three steps:

1) Denaturation – DNA sample is heated (~90ºC) to separate the two strands
2) Annealing – Sample is cooled (~55ºC) to allow primers to anneal (primers designate sequence to be copied)
3) Elongation – Sample is heated to the optimal temperature for a heat-tolerant polymerase (Taq) to function (~75ºC)

Taq polymerase is an enzyme isolated from the thermophilic bacterium Thermus aquaticus

As this enzyme’s optimal temperature is ~75ºC, it is able to function at the high temperatures used in PCR without denaturing
Taq polymerase extends the nucleotide chain from the primers – therefore primers are used to select the sequence to be copied

Question 32

Describe the one gene, one polypeptide rule

Answer 32

Typically, one gene will code for one polypeptide – however there are exceptions to this rule:

Genes may be alternatively spliced to generate multiple polypeptide variants
Genes encoding tRNA sequences are transcribed but never translated
Genes may be mutated (their base sequence is changed) and consequently produce an alternative polypeptide sequence