CST REVIEW Flashcards
What are the 4 biomolecules?
Proteins, carbohydrates, lipids and nucleic acids
What is the name of the building blocks of a protein?
amino acids
What is the term used to describe the ability of a cell’s membrane to be selective in what goes in and out of a cell?
semipermeable
What is the main difference between a prokaryotic cell and a eukaryotic cell?
has a nucleus
what things do eukaryotic and prokaryotic cells have in common?
cytoplasm, cell membrane, DNA, ribosomes
What is the function of a ribosome?
to make proteins/protein synthesis/translation
What is the purpose of an enzyme?
to speed up the rate of a chemical reaction
What group of biomolecules does an enzyme belong to?
proteins
Which biomolecules are nonpolar and do not dissolve in water?
lipids
Why can antibiotics kill bacteria and not kill viruses?
Bacteria are cells that get in among our own cells and reproduce and the antibiotics can kill them without killing our cells. Viruses invade the cell and attach to the DNA so the only way to kill them is to kill the infected cell and our bodies do not know the difference between infected and noninfected cells.
What are the steps to making a protein?
DNA unwinds in nucleus
mRNA copies one side of the strand in process of transcription
mRNA leaves nucleus and enters cytoplasm
mRNA are then copied by tRNA for translation
Codon (group of 3) match with the RNA bringing amino acids to make chain to form a protein
Which parent’s chromosomes determines the sex of the human baby?
the father X or Y
mom can ONLY contribute an X
What is the process called when the fusion of gametes occurs, resulting in a new combination of alleles?
Fertilization
Why is reproduction NOT considered a necessary process for life?
Reproduction is not NECESSARY for life to maintain homeostasis. It is only necessary to keep the species going in the future.
What is the term used to describe the body when all things are working well and the organism is healthy?
Homeostasis
What are the steps to the scientific method?
What must be true for research to be accepted and become a law or theory?
Observation –> Research–> Hypothesis–> Experiment (data collection)–> Results–> Conclusions
The experiment must be duplicated many times before it can be accepted.
What is the biological heirarchy from smallest organisms to largest groups?
atom–> molecule–> biomolecules–> organelles–> cells–>tissues–> organs–> organ systems–> organism–> population–> community–> ecosystem–> biome–>
If a solution has a pH of 5.4 is it classified as an acid or a base?
acid
pH>7 = base
pH< 7 = acid
pH = 7 neutral (water)
Why does water make such a good solvent for a solution in living things?
It is POLAR and can dissolve things easily.
What are the 4 building blocks of DNA called?
Nucleotides
Guanine, Cytosine, Adenine and Thiamine
How many codons can the piece of mRNA code for?
UUAGCGAAAUCCGCGCUAAGUCGA
What would be the sequence of amino acid codons in the chain?
8 codons of 3
AAU CGC UUU AGG CGC GAU UCA GCU
What is the function of the golgi?
To package the materials the ER makes and ship them out in vesicles.
What are the organisms at the bottom of a food pyramid called?
producers
An organism that can produce its own food is called a _______________.
Autotroph
(Heterotrophs have to get their food from an outside source)
What are the major biomes on the earth?
Desert, tundra, grassland, rainforest, savanna, deciduous forest, taiga, oceans, lakes
Algae–> Minnow–> Bass–> Bear
What would happen to the food chain above if a nonindiginous species was introduced into the river of the bass?
There would be competition for food and the bass may die out, leaving the minnow population to grow and the bear population to decline.
White blood cells are also called what?
Leukocytes
(white….cells)
Hormones are secreted by ….
Endocrine glands
What are at least 4 structures that are found in skin?
sweat glands, oil glands, hair, sensory nerves, blood vessels, fat, melanocytes, dermal cells,
What are the differences between a phenotype and a genotype?
Phenotype is the trait seen in the organism
Genotype is the alleles in the chromosomes that determine the phenotype.
The nonliving factors in the environment of an ecosystem are called
abiotic factors
(a) without
(bio) life
- ic condition of
(BIOTIC would be the living factors)
What is the name of the energy molecule produced by cellular respiration?
ATP
What are the products of the photosynthetic process in a plant?
oxygen gas and glucose sugsr
How are cellular respiration and photosynthesis linked together?
opposite directions of the reaction
Photosynthesis CO2 + H2O –> C6H12O6 + O2
Cellular Respiration C6H12O6 + O2 –> CO2 + H2O
What are 3 things plant cells have that animal cells do not have?
chloroplasts
a large central vacuole
cell wall
What are the 2 major organs of the central nervous system?
Brain and spinal cord
The genes for red hair and freckles are usually inherited together because these genes are…
located on the same chromosome and inherited together
In one species of plant, red flowers are dominant and white flowers are recessive. If this trait follows a pattern of incomplete dominance, a heterozgous offspring would have what color flowers?
PINK
red and white mixed together
If a solution contains more solute on the out side of a cell than the inside of the cell which way will the water flow?
Water will flow out of the cell into the hypertonic solution
A diagram that shows the orderly arrangement of all the human chromosomes is called a ______.
Karyotype
If someone is diagnosed as having a compromised immune system, what does this mean when the person gets sick?
A compromised immune system means a person cannot fight off and survive infections by microorganisms that are usually harmless to the person.
Black fur is dominant to white fur in guinea pigs.
What will the phenotype and genotype ratios of the offspring be if a cross is done between 2 heterozygous parents?
Bb X Bb
BB 1/4 25% Black Homozygous Dominant
Bb 1/2 50% Black Heterozygous
bb 1/4 25% white homozygous recessive
Most of the water in the earth’s water cycle is found where?
Oceans
How does carbon get released into the atmosphere?
the burning of wood and fossil fuels
Why are the bacteria and fungus known as decomposers important to the nitrogen cycle?
They break down the dead stuff and recycle it into the earth. They can also pull nitrogen from the air through a process called denitrification.
Why do doctors need to be concerned when a patient enters the hospital with a high fever?
Enzymes in the body will begin to break down as heat will denature them, causing them to lose their specific shape to work with their substance in a reaction. As a result the body will not work efficiently any more.
What systems are responsible for maintaining the appropriate levels of oxygen in our cells?
Respiratory- exchanges the oxygen from atmosphere for the Carbon dioxide waste from our cells
Circulatory- transports the oxygen to the cell and carbon dioxide away from the cells
Nervous - monitors the levels of the oxygen in body to determine heart rate and beathing rate
What is the difference between hypertonic, hypotonic and isotonic solutions? How does the concentration of a solution affect the movement of water in and out of cells and tissue in our body?
Hypertonic: lots of solute in little water outside the cell membrane CONCENTRATED
Hypotonic: little solute in lots of water outside the cell membrane DILUTE
Isotonic: same amount of solute and water on both sides of the cell membrane
WATER WILL ALWAYS FLOW FROM HIGH WATER AMOUNT (LOW CONCENTRATION)
TO LOW WATER AMOUNT (HIGH CONCENTRATION)
How are antibodies formed in the body and what do they do?
Antibodies are formed by
1) getting a vaccine which triggers body to produce antibodies against that specific disease
2) natural immunity when a person gets sick and body makes antibodies to kill microorganism (bacteria or virus)
The antibodies will remain in our blood and fight off the microorganism if it should show up again.
Biology means…. and includes the study of……
the study of life…..
cells, DNA, body systems, the environment, relationships between living things, chemistry (macromolecules), disease,
can include anything to do with LIFE
