Certification Exam Practice Questions Flashcards
Which statement about shipping blood for HLA typing is false, as of 2020?
D
A. Shipping is regulated by the DOT and IATA
B. Specimens must be packed in a 3-container system
C. There must be sufficient absorbent material to soak up a spill
D. Blood specimens known to carry pathogens are packaged the same as routine diagnostic specimens
Which is not part of universal precautions when performing a blood draw?
E
A. Wear a lab coat or gown
B. Change gloves between each patient
C. Do not recap, break, or resheath needles
D. Use a sharps container for disposal of all needles
E. Inform the patient of your HIV status
Liquid nitrogen present what danger to personnel?
Frost bite, suffocation
What is a fire assembly area?
A predetermined safe place to meet during a fire
Reagent X arrives in the lab without an expiration date. What action should you take?
Periodically QC the reagent and develop a QA analysis of its performance to derive an appropriate expiration date
You have finished doing an HLA typing and ABSC on a potential kidney recipient, but the patient decides they don’t want to be listed for transplant. What should you do with the reports and other patient records you have, some of which are online in the lab’s LIS and some of which are on paper?
Save all electronic and paper records for at least 2 years, as long as the LIS is backed up regularly and paper storage is secure
If you counted 311 cells in 3 of the 4 outside squares of a hemacytometer and the sample was initially diluted 1:8, what is the cell concentration?
8.3 x 10^6 cells/mL
A 100 uL stock solution of DNA is at 160 ug/mL. To what final volume should you dilute the stock to achieve a working concentration of 40 ng/uL?
400 uL
Solution three results from combining all of solution one with solution two. Solution one consists of 2.0 mL of cells at a concentration of 5 x 10^6 cells/mL. Solution two consists of 7.0 mL of cells at a concentration of 3 x 10^6 cells/mL. What is the cell concentration in solution three?
3.4 x 10^6 cells/mL
You are validating a new procedure in the lab and the list of reagents includes 2N H2SO4. Which of the following is equivalent to 2N H2SO4? The molecular weight of H2SO4 is 98 g/mol.
9.8 g H2SO4 in 100 mL H2O
If 100 g of NaCl (Na=22.99 g/mole, Cl=35.43 g/mole) are dissolved in 1500 mL of water, what is the molarity of the resulting solution?
1.14M
To make physiological saline, approximately how many grams of sodium chloride are required per 100 mL of water?
0.85
Given an adult bone marrow transplant patient’s WBC is 5.0 x 10^3 cells/uL with 20% lymphocytes, and 2,000 lymphocytes/well are required for a Class I typing on two 72-well trays, what is the minimum blood volume needed for testing?
2 mL
T or F? EDTA chelates calcium and is acceptable for CDC assays.
False
T or F? EDTA is acceptable for flow cytometry assays.
True
T or F? Serum is better than plasma for PRA testing.
True
T or F? Heparin may interfere with Taq polymerase in PCR reactions.
True
T or F? It is acceptable for a red top to be collected from a patient who is at that moment receiving a dialysis treatment.
False
T or F? Blood shipped to the lab for serology testing should be kept at 4 C
False
T or F? Patients receiving long-term steroid treatment may have insufficient lymphs for HLA testing
True
T or F? Patients receiving blood products should have their blood collected for HLA typing immediately following the transfusions to ensure adequate cell numbers
False
T or F? WBC count and differential results on leukopenic and pediatric patients can be used to determine the volume of blood needed for testing.
True
T or F? Requisition forms must include name of an authorized requester.
True
T or F? Plain red top, EDTA, and ACD are all acceptable samples for ABO blood grouping.
True
T or F? Lymphs from EBV transformed cell lines react the same as PBLs in CDC assays
False
T or F? Blood spotted on SS 903 cards and stored for 1 year at room temp is an acceptable sample
True
T or F? EDTA blood stored for 1 year at room temp is an acceptable sample
False
T or F? ACD tubes maintain cell viability better than heparin during long transit times
True
Which is unacceptable for HLA phenotyping by serology?
E
A. Blood collected in sodium heparin
B. Blood collected in CPDA-1
C. Blood collected in ACD solution A
D. Blood collected in ACD solution B
E. Blood collected in EDTA solution
Which of the sample sources below yields the greatest number of B cells?
C
A. Whole blood
B. Thymus
C. Spleen
D. Lymph node
Which statement is true regarding the relative number in normal blood?
B
A. Lymphocytes > RBC
B. Granulocytes > Lymphocytes
C. RBC > Platelets
D. Lymphocytes > WBC
Which is a valid separation technology?
B
A. T cells via surface IgM binding to magnetic beads
B. Macrophages via uptake of iron filings
C. B cells via CD8 binding to magnetic beads
D. Neutrophils via segregation into the buffy coat layer of a standard ficoll-hypaque gradient
Lymphocytes for crossmatching can be separated from other whole blood components based on which characteristic?
D
A. Their density
B. The CD antigens present on the cell surface
C. Their inability to phagocytize particles
D. All of the above
E. A and B only
How should whole blood specimens drawn into ACD anticoagulant for use as target cells in crossmatching be stored?
At room temp, protected from heat and cold
Why is less blood for lymphocyte isolation usually needed from children when compared to adults?
Children usually have a higher total WBC count compared to adults; Children usually have a higher percentage of lymphs compared to adults
Which of the following is the preferred sample for DNA extraction?
E
A. Whole blood without anticoagulants
B. Red blood cells
C. Heparinized serum
D. Platelets
E. Whole blood with ACD anticoagulant
The absolute A260 and A280 values and their ratio for a DNA sample provide what information?
RNA/Protein contamination of DNA
Which of the following samples can be used for determining a patient’s Class I HLA type with a DNA based method?
E
A. 5 mL Ficoll separated PBL’s (1 x 10^5 cells/mL) in PBS
B. 2 mL peripheral blood in EDTA
C. 3 mL B cells (1 x 10^5 cells/mL) in PBS, isolated by negative selection magnetic beads
D. Both A and B
E. All of the above
When using a spectrophotometer to quantitate DNA, the optimal A260/A280 ratio for purified DNA should be:
1.8-2.0
Which sample would be least preferred for CDC PRA testing?
D
A. Plain red top tube
B. Serum separator tube
C. Frozen serum aliquot
D. ACD yellow top tube
Thrombin or CaCl2 is typically used for?
Clotting anti-coagulated plasma
What treatment of serum causes the chelation of magnesium and calcium?
EDTA
The use of pronase in a flow crossmatch assists in removing non-specific binding due to Fc receptors, as well as:
Removing CD20 from the cell surface
Dead cells stained with acridine orange and ethidium bromide (AO/EB) appear orange because:
Ethidium bromide emits an orange-red fluorescence that dominates over AO when bound to DNA fragments in the nuclei of dead cellsFi
Ficoll-Hypaque separates lymphs based upon what inherent property?
Density
What effect do heterophile antibodies in complement have on the AHG-CDC assay?
Enhances the effectiveness of the complement
Human serum accidentally contaminates the anti-human globulin (AHG) stock solution. What is the expected effect in the AHG-CDC assay?
Many false negative reactions
What is the usual source of complement used in the CDC crossmatch assay?
Rabbit
Which of the following is true about storing fluorescent reagents, including monoclonal antibodies and microbead assays?
B
A. Ensure reagent is kept frozen as much as possible, so replace vial in the freezer between runs
B. Ensure reagent is kept in the dark to avoid photobleaching, so use light blocking vials and store them in a closed box.
C. Ensure reagent is not frozen, so leave vials at 4 C or on the bench
D. Ensure reagent receives sufficient light to activate fluorescence, so leave vial on the counter with the lights on for at least 1 hour before use
The usual final concentration of DMSO for freezing lymphocytes is:
10%
A short DNA oligonucleotide used for PCR-SSP amplification is properly termed a:
PrimerWhi
Which of the listed probes will have the highest Tm?
B
A. AACTAGTTA
B. CTATGGATCGTTGGCTACTCT
C. GTAGATTATATTACTCTAGCA
D. AACTAGTTC
E. ATATATATAT
Primers and probes bind to their DNA targets through a process known as:
Hydrogen bonding
Which is true of the 3’ and/or 5’ ends of an oligonucleotide primer?
D
A. The 3’ and 5’ ends must be complementary to one another
B. The 3’ and 5’ ends must be either C or T (a pyrimidine)
C. Extension of the DNA sequence will take place at both the 3’ and 5’ ends of a primer
D. The 3’ end is the critical portion for determining the specificity of a primer
E. The sequence in the middle of the primer is the critical portion for determining the specificity of a primer
Which is true regarding the DNA polymerase used in PCR?
D
A. The enzyme should only incorporate dideoxy nucleotides
B. The enzyme should have low fidelity
C. The enzyme should denature at 37 C
D. The enzyme must be heat resistant
The structural components of a nucleotide are:
Base, sugar, phosphate
A 2% agarose gel has what advantage compared to a 0.8% agarose gel in electrophoresis?
The gel is better able to separate low molecular weight DNA fragments
What is true regarding dUTP?
D
A. Nucleotide in unamplified DNA
B. Similar to dCTP in base-pairing
C. RNA sugar
D. dUTP can be substituted for dTTP in PCR
Why should you not store enzyme reagents (Taq) in a frost free freezer?
Frost free freezers have temp fluctuations during defrost cycles
Where should SSO probes be designed to have their target mismatches in order to maximize specificity?
In the center of the probe
Tris-EDTA buffer, pH 8.0, is the recommended buffer for long-term storage of DNA, especially at 4 C. How does it work?
The high pH inhibits acid hydrolysis while the EDTA inhibits nucleases
Formamide and TMAC can be used in what assay for what purpose?
SSOP: To enhance annealing specificity
Molecular typing usually uses genomic DNA as a starting material. If RNA is converted into cDNA for typing, what feature is missing that may require adaptation of methodology from genomic DNA typing?
Introns
A sample is received by a lab and no one knows that it has a new B locus allele. The new allele has a point mutation in a region of exon 3 that had previously been considered monomorphic. What technique would be likely able to detect it?
Sequencing
High resolution Class I and Class II typing is most important in which of the following situations?
C
A. Living-related kidney transplantation with high PRA
B. ABO-mismatched liver transplant
C. Unrelated hematopoietic stem cell transplantation
D. Autologous hematopoietic stem cell transplantation
E. Two haplotype matched living related hematopoietic stem cell transplantation
Which statement is true about the amplification of DNA by PCR?
C
A. PCR does not require the two strands of DNA to be denatured
B. PCR requires an enzyme that cuts the DNA at specific nucleotide sequences (ie. a restriction enzyme)
C. PCR requires two primers to initiate DNA synthesis
D. The molecular weight of the amplified DNA is not diagnostic of PCR specificity
E. The PCR reaction cycle takes place at a constant temperatureA
A colleague sends you a sample with a potentially novel allele. Which HLA typing technology should be used to characterize this allele for submission to the HLA reference database?
DNA sequencing
