BIO m3 Flashcards
Why was the blending hypothesis of inheritance a major concern (and irritant) to Charles Darwin?
The blending hypothesis of inheritance (genetic traits of two parents are blended) was a major concern because blending requires variation. It was an irritant to Charles Darwin because blending reduces variation.
Mendel studied peas. Why was this a perfect study organism and a very intelligent decision on Mendel’s part? How did Mendel ‘strike it lucky’ with pea plants and the characters he studied?
the garden pea was an ideal study organism because:
• mating is easy to control (normally self pollinating)
• many true-breeding varieties were available that had characters with distinct heritable traits
Strictly speaking, the underlying basis is independent assortment of chromosomes. Mendel was lucky he used pea plants because the traits were largely found on separate chromosomes. If the genes were found on same chromosome, they could be linked and would not show perfect independent assortment.
Outline the Mendel’s model of inheritance, including two laws
Law of Segregation: only one copy of a heritable factor is passed on to offspring by each parent, and which factor is passed is randomly determined
Law of independent assortment: the emergence of one trait will not affect the emergence of another. Mendal’s experiments with two traits showed 9:3:3:1 ratios. Mendel concluded that each organism carries two sets of information about its phenotype. If the two sets differ on the same phenotype, one of them dominates the other. That way, information can be passed on through the generations, even if the phenotype is not expressed & it tracked that parent’s alleles are inherited independently
Explain Mendel’s experiments – single cross and two-trait cross
Mendel’s first experiment: Hybrid Cross (single character)-flower colour
•tested what happens when two true breeding varieties were crossed- hybrid cross
•first generation (F1) showed only one trait
•second generation (F2) showed two traits with no dilution
•Mendel reasoned that one heritable trait, purple, was dominant while the other, white, was recessive
•the recessive trait would reappear in the F2 generation in the ratio 3:1
Mendel’s second experiment: Dyhibrid-seed color and shape
Mendel second experiments was with dihybrid crosses where he tracked two characters from parents true breeding for both characters. He had 2 hypothesis:
1. alleles are inherited together
vs
2. alleles are inherited independently
Independent assortment was supported. Mendel was lucky that his traits were largely found on separate chromosomes since genes found on same chromosome may be linked, and may not show perfect independent assortment.
What are linked traits? If curly wings and white eyes were linked genes, how might your results from above been affected?
Linked traits are genes thast are found on the fame chromosome. Genes close together are more linked than genes further apart. If curly wings (sss) and white eyes (rr) were linked, they may not show perfect independent assortment where emergence of 1 trait will not affect the emergence of the another.
Are dominant traits more common than recessive traits?
no, recessive traits can sometimes be common in the population. Dominant traits can be expressed over recessive traits, however this does not mean they are more frequent.
Is it possible to do punnet squares with non-mendelian traits (ex: multiple alleles, incomplete dominance)?
Yes because most genes have multiple phonetic effects (pleiotropy) and a gene can interact with another gene (epistasis, ex: mammal coat colour)>
- Codominace-both alleles expressed @ same time ex: MN blood groups
- Incomplete dominance-heterozygotes express an intermediate pheonotype (ex:snap dragon)
- Multiple allele- most alleles have more than just 2 varieties (alleles) ex: ABO blood group
- Reaction norm-expression of genotype is modified by environment (ex: skin colour)
What is the difference between epistasis and pleiotropy? Are these types of traits mutually compatible? That is, is it possible that a character has both epistasis and pleiotropy?
Yes, epistasis means that 2 genes interact with one another, pleiotropy means 1 gene has multiple affects and those can happen at the same time. So, genes can interact and each can have multiple effects.
Ex: pleiotropy-cystic fibrosis, tay sachs
What types of point mutations are possible? What types of chromosomal mutations are possible? Are these mutations heritable?
1.Substitution
• May be blind- causing no effect
or…..
• Missense-changing and amino acid of a polypeptide
2.Insertions & Deletions
• Usually have serious effect on polypeptide due to reading frameshift (A type of gene mutation wherein the addition or deletion of (a number of) nucleotide(s) causes a shift in the reading frame of the codons in the mRNA, thus, may eventually lead to the alteration in the amino acid sequence at protein translation. -Ex: cystic fibrosis)
*most hereditary diseases are caused by a variety of point mutations (substitutions or frameshifts)
• Ex: Tay Sachs-caused by defective hexosaminidase enzyme, over 100 different point and frameshift mutations of the HEXA gene known
• Ex: PKY (phenylketonuria) caused by defective PAH gene, over 400 diff point and frameshifts mutations known)
Under what conditions would chorionic villi sampling be preferable to amniocentesis?
It would be preferable to amniocentesis if terminating the pregnancy is being considered because amniocentesis can only be done 15- 20 weeks along in the pregnancy while results are either fast- several weeks long. Chronic villi sampling however can be done at 8 weeks and has faster results
Discuss personal and societal ethical issues concerning genetic screening.
Personal Ethics: what would a person do if they have a positive result?
• Alter behavior?
• Behave poorly if not susceptible?
• Some diseases are untreatable
• Genetic markers in relation to developing the disease is generally weak.
Societal Ethics: who will be aware of the positive results?
• Government medical system other branches of government?
• Private medical system- will data be shared?
• Direct to consumer genetic tests: murky privacy policies
Why might a doctor be hesitant to request a genetic test on a patient behalf.
He may be hesitant because of
- Personal ethics: what a person would do if they had a positive result
- how significance the genetic trait actually is. Ex: cancer- usually many mutations required to cause cancer
Contrast the replication of bacterial and eukaryotic chromosomes. How do eukaryotes avoid a limitation they have but bacteria lack?
Prokaryotes:
- smaller chromosomes
- replicate faster
- circular chromosome
- transcription and translation happen in cytoplasm
- dna–>rna–>polypeptide
Eukaryotes:
- larger chromosome
- linear chromosome
- chromosomes have telomeres
- transcription in nucleus, mRNA exits nucleus, translation happens in cytoplasm
- transcription starts with TATA box ( a seq of DNA that is all thymine & adenines so transcription factors attach to it and the promoter)
- DNA primary transcript–> must be converted into mRNA by rna processing–> polypeptide
Limitation of Eukaryotes:
-24 hrs to replicate due to chromatin unpacking & proofreading enzymes to counteract that they have multiple replication origins per chromosome
Why is the genetic code redundant and not ambiguous?
There are multiple codons for each amino acid and there is not a single codon that codes multiple amino acids. You cannot swap them around. It serves as a built in resistance to mutation and allows a certain amount of mutations to happen without affecting the organism.
What are the implications of the finding that the genetic code is universal (the same in all organisms)?
- That everything came from a common ancestor
- Biotechnology- the exploitation of biological processes for industrial and other purposes- genetic manipulations of microorganisms then can be used for the production of antibiotics, hormones, etc.
Contrast the location of transcription and translation in prokaryotes versus eukaryotes.
Prokaryotes:
• Prokaryotes: In prokaryotes, transcription and translation both happen in the cytoplasm.
Eukaryotes:
• transcription happens in the nucleus and mRNA exits nucleus because translation happens in the cytoplasm.
What are two kinds of RNA that are not translated?
tRNA AND Rrna are not translated into Proteins , they help in translating mRNA into proteins
• tRNA helps in bringing amino acids to the site of translation
• rRNA : Its part of Ribosomes where translation takes place, it helps in holding mRNA with Ribosome while translating mRNA to Protein.
• Splicosomes for bacteria
• Transcribe and translate the following sequence. Assume the template strand is on the bottom. Use the
codon table in your text or the lecture presentation file.
Find start codon-> transcribe to rna (base pair rules A=U)→ stop codon→ write codes with chart
5’ TATATATGACTGATCCTTGATTTACTGAAAA 3’
3’ ATATATACTTCCTAGGAACTAAATGACTTTT 5’ (template strand)
Answer on paper
• How is transcription initiation in eukaryotes a much more complicated affair than in prokaryotes? Why is it so much more complicated?
eukaryotic gene regulation tends to be more complicated because eukaryotes are faced with complexities that differ from their prokaryotic counterparts. Eukaryotes have more complicated cell structures that contain many more proteins and a variety of cell organelles. Many eukaryotes such as animals and plants are multicellular and contain different cell types. Animal cells may differentiate into nerve cells, muscle cells, and skin cells, among others. Furthermore, animals and plants progress through developmental stages that require changes in gene expression. For these reasons, gene regulation in eukaryotes requires much more coordination.
**eukaryotic genes, particularly those found in multicellular species, are regulated by many factors. The combination of many factors determines the expression of any given gene. At the level of transcription, common factors contribute
• control elements, activators, mediators, transcription factors, promoter & TATA box all have to be in place, and only then does RNA polymerase attach →and then you get transcription.
What are the three RNA processing events we learned?
- G3P cap (guanosine triphosphate) added to 5’ end helps transcript bind to a ribosome
- Polyadenylation- enzymes recognize a polyadenylation signal and adenylate the 3’ tail and make transcript more robust
- RNA Splicing- a two step reaction in which introns are removed from a primary rna transcript and exons are joined together to form a mature mrna. An intron usually contains a clear signal for splicing, but in some cases a splicing signal may be masked by a regulatory protein. This results in alternative splicing. In rare cases a pre-mrna may contain several ambiguous splicing signals, resulting in a few alternatively spliced mrna.
- Exons (a segment of a DNA or RNA molecule containing information coding for a protein or peptide sequence.) & Introns (a noncoding segment in a length of DNA that interrupts a gene-coding sequence or non-translated sequence, the corresponding segment being removed from the RNA copy before transcription. )- most eukaryotic genes contain non-coding segments and the RNA transcript must be spliced, removing introns and joining exons to leave a finished RNA
How much of the human genome codes for proteins?
Exons (regions of genes coding for protein rRNA or tRNA) is 1½ percent of the human genome
What does the rest of the genome do?
1.Introns cut out and regulatory sequences- can turn some genes on and some off (24%)—control and characterization
2. Junk DNA- do not know what it does (74%)
• Repetitive DNA-can turn some genes on and some off, introns cut out (15%)
• Unique Non-Coding-perhaps associated with organizing DNA in nucleus
• Parasitic DNA-self amplifying sequences, some inactive retroviruses- not doing anything good for organism
Do complex organisms require more DNA? Speculate on why and/or why not.
Maybe, maybe not. Eukaryotes are more complicated than bacteria only to a certain point. There are lots of complexities however they contain junk and some excessive DNA that does not do anything
Define Alelle.
an alternative form of a gene. One of two or more slightly different versions of a gene that code for different forms of the same trait.
Define homolougue
a chromosome that is similar in physical attributes and genetic info to another chromosome with which it pairs during meiosis. A member of a homologous chromosome
Define homologous chromosomes
a pair of chromosomes that have genes for the same trait. One member from each pair came from each parent. Homologous chromosomes are the same size and shape and line up with one another during meiosis.
Define homozygous
having 2 identical alleles for a particular gene
Define heterozygous
having 2 different alleles for a particular gene
Define dominant allele
the allele that is fully expressed in the phenotype of the individual who is heterozygous for that gene. The dominant allele usually produces a functional protein, whereas the recessive allele does not.
Define recessive allele
the allele whose effects masked in the heterozygous condition. The recessive allele often produces a non functional protein.
Define Independent assortment
in genetic inheritance, a principle that states that the alleles of unlinked genes (those that are located on different chromosomes) are randomly distributed to gametes
Define genotype
the genetic makeup of an individual. It refers to precise alleles that are present
Define phenotype
the observable physical and physiological traits of an individual. Phenotype results from the inherited alleles and their interactions with the environment
Define Codominance
both alleles expressed at same time. Ex: MN blood groups, (spotted, speckled)
Define Incomplete dominance
heterozygotes express an intermediate phenotype ex: snap dragon
Define reaction norm
expression of genotype is modified by environment. ex: skin colour
Define multiple allele
most genes have more than just 2 varieties (alleles) ex: ABO blood group
What is epistasis?
a gene interacts with another gene ex: mammal coat colour
What is pleiotropy?
most genes have multiple phonetic effects
What are characteristics of Dominant Pedigrees
- homozygotes HH and heterozygotes Hh express trait
- doesnt skip generations
- males &females affected
- not on sex chromosome
What is Huntington’s Disease?-dominant autosomal
- a defective protein is toxic and accumulates in nerve cells.
- it is a neurodegenerative disease
- symptoms include convulsions, lack of motor control
What are characteristics of Recessive Autosomal pedigrees.
- heterozygotes Hh and homozygotes HH do not express traits
- skips generations
- males and females affected
- more likely in consenguous marriages
- not on sex chromosome
- hh express
What is PKY (Phenylketonuria)?-recessive autosomal
- enzyme for breaking down amino acid phenylalanine is defective.
- Build up causes growth defects including cognitive impairment.
- it can be managed with a proper diet.
What is cystic fibrosis?-recessive autosomal
1.involves a defective chloride channel.
2.it mainly affects secretory epithelial cells, resulting in excessive mucous
3.digestive organs damaged
pancreas-diabetes
lung accumulate mucous
4.most common a.r gene
What is Tay Sachs?-recessive autosomal
- a lysosomal disorder
- defective enzyme breaks down a glycolipid
- neurodegenerative diseases
- usually fatal by age 4
What are characteristics of a recessive X-link pedigree?
sex chromosomes carry many genes unrelated to sex
- female carriers (Heterozygotes XcX) do not express
- males express with only one allele (X chromosome)
- female homozygotes express XcXc
- skips generations
- males almost always, but females possible
What is hemophilia?-recessive X linked
- defective clotting factor VII or clotting factor IX
- prior 1960’s lifespan was 11 yrs
- now with management lifespan almost normal
Who does red/green colour blindness affect the most?why?-recessive x linked
males more than females because males express with only one allele (X chromosome). Females have 2 x chromosomes and heterozygotes do not express it so there is less chance of them getting it, though it is still possible
What is dominant X linked?
Describes a dominant trait or disorder caused by a mutation in a gene on the X chromosome. The phenotype is expressed in heterozygous XcX females as well as in males (having only one X chromosome); affected males tend to have a more severe phenotype than affected females.
Define replication fork
a Y shaped part of a chromosome that is the site for DNA strand separation and then duplication
Define leading strand
the leading strand is the strand of DNA which is being synthesized in the same direction as the growing replication fork
–polymerase reads the leading strand template and adds complimentary nucleotides to the nascent leading strand on a continuous basis
Define lagging strand
the lagging strand is the strand of the nascent DNA whose direction of synthesis is opposite to the direction of the growing replication fork
–synthesized in short separated segments. Primase reads the template DNA and initiates synthesis of a short complementary RNA primer. DNA polymerase extends the primed segments forming okazaki fragments. The RNA primers are then removed and replaced with DNA, and the fragments of DNA are joined together by DNA ligase
Define helicase
is an enzyme that unwinds a segment of the DNA molecule
Define Primer
a primer is a strand of nucleic acid that serves as a starting point for DNA synthesis
Define DNA pol 3
adds nucleotides to the synthesizing strand (can only elongate, go in 1 direction, cannot start polymer/build from scratch, once hits rna it stops)
Define DNA pol 1
gets rid of the DNA primer on the lagging strand that are located at the okazaki fragments. (replaces primer with dna nucleotides)
Define primase
is an enzyme that creates a short RNA sequence, called a primer, on a DNA template strand so that DNA polymerase can make a copy of that DNA strand( initiates a new strand of nucleic acids)
Define ligase
connects okazaki fragments together
Define single stranded binding proteins
bind to an stabilizes single stranded DNA during DNA replication until the single strand DNA can be used as a template
Define replication bubble (in bacteria)
a DNA replication bubble occurs during the replication process. As the double stranded DNA is unwound, a replication bubble forms. At the bubble, a replication complex forms, & the DNA replicated in both directions, causing a replication fork.
What is a start codon?
marks the site at which translation into protein sequence begins where it starts AUG, and the stop codon marks the site at which translation ends or stops at UAA UAG as the mRNA is being read
What is junk dna?
don’t know what it is:
- repetative dna
- unique non coding- mb associated w organizing dna in nucleus
- parasitic dna- self amplifying sequences, some inactive retroviruses- not doing anything good for the organism
What is sickle cell anemia?
a severe hereditary form of anemia in which a mutated form of hemoglobin distorts the red blood cells into a crescent shape at low oxygen levels. It is most common among those of African descent.
