ASCP MB Exam

Question 1

What assay amplifies the target using a combination of a three-enzyme system?

Answer 1

Nucleic acid sequence based amplification (NASBA)

Question 2

In real-time PCR, what is amplified?

Answer 2

The target

Question 3

Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence?

Answer 3

58C

Question 4

Splicing

Answer 4

is not a source of DNA damage

Question 5

Which type of RNA molecule is responsible for transporting amino acids during protein synthesis?

Answer 5

tRNA

Question 6

Given the anti-sense strand of DNA: 5’-AATTGCCGACATAGAT-3’ what is the sense strand?

Answer 6

5’-ATCTATGTCGGCAATT-3

Question 7

What adjustment is unlikely to increase the specificity of a PCR reaction?

Answer 7

Decreasing the annealing temp of primers

Question 8

Components of nucleic acids

Answer 8

phosphate group
sugar (ribose or deoxyribose)
nitrogenous base

Question 9

What characteristic of the genetic code facilitates ID of open reading frames in DNA sequences

Answer 9

Out-of-frame or chance consecutive codons tend to be short, often ending in a stop codon

Question 10

On a size-exclusion column, large molecules will elute ____ small molecules

Answer 10

Before

Question 11

MALDI methods separate ions by

Answer 11

mass and charge regardless of volume

Question 12

What is a heteroduplex

Answer 12

One double-stranded DNA molecule w/one or more non-complementary bases

Question 13

What method IDs the presence of a mutation but not the mutant sequence

Answer 13

SSCP

Question 14

What is the function of DNA in the cell?

Answer 14

To act as a storage system for genetic information

Question 15

How do purines and pyrimidines differ?

Answer 15

Purines have a double ring, pyrimidines have a single ring

Question 16

Which of the ribose carbons participate in the phosphodiester bond?

Answer 16

The 5’ C connects to a hydroxyl group on the 3’ ribose C of the previous nucleotide.

Question 17

Which of the ribose carbons carries the nitrogen base?

Answer 17

The 1’ C

Question 18

Why does the DNA polymerase require primase activity?

Answer 18

A 3’ hydroxyl group from an existing nucleotide must be present to form the phosphodiester bond.

Question 19

How does DNA move from cell to cell via conjugation?

Answer 19

DNA is shared by direct cell-to-cell contact

Question 20

How does DNA move from cell to cell via transduction?

Answer 20

Viral or bacteriophage vectors carry DNA from cell to cell.

Question 21

How does DNA move from cell to cell via transformation?

Answer 21

Fragmented or plasmid DNA enters cells from the surrounding environment

Question 22

After meiosis, games produced from diploid organisms are _____.

Answer 22

Haploid

Question 23

List the three processing steps undergone by messenger RNA

Answer 23

mRNA is capped during transcription and polyadenylated as part of termination. The transcript is further processed by splicing

Question 24

What is the function of polyadenylate polymerase?

Answer 24

It adds adenosine nucleoties to the 3’ end of mRNA

Question 25

The parts of the hnRNA that are translated into protein are the ______.

Answer 25

exons

Question 26

The intervening sequences that interrupt protein-coding sequences in hnRNA are _____.

Answer 26

introns

Question 27

A procedure for DNA digestion w/a restriction enzyme includes a final incubation set of 5 min at 95C. What is the likely purpose of this final step?

Answer 27

This step will inactivate the protein, preventing its activity in subsequent steps in the assay.

Question 28

What is a ribozyme?

Answer 28

RNA molecule that can metabolize other molecules like an enzyme

Question 29

What is the nonprotein prosthetic group for glycoprotein?

Answer 29

sugars

Question 30

What is the nonprotein prosthetic group for lipoprotein?

Answer 30

lipids

Question 31

What is the nonprotein prosthetic group for metalloprotein?

Answer 31

metal atoms

Question 32

Exosomes

Answer 32

Small vesicles that form by invagination and budding from the inside of cellular endosome vesicles and are secreted by living cells. They contain proteins, lipids, and nucleic acids and can be collected by centrifugation.

Question 33

Automated DNA isolation systems use cartridges containing what

Answer 33

lysis, adsorption, and elution agents, and magnetic beads

Question 34

Chelex

Answer 34

cation-chelating resin that can be used for simple extraction of DNA from minimal samples

Question 35

Most abundant type of RNA

Answer 35

rRNA (80-90%)

Question 36

RNA on a gel

Answer 36

High-quality total RNA appears as two rRNA bands reprsenting large (28S) and small (18S) ribosomal RNA species

Question 37

Beer-Lambert law

Answer 37

Used to determine concentration from the absorptivity constants (

Question 38

What describes the two types of bacteriophages

Answer 38

Virulent or temperate

Question 39

Which technique can be used to detect epigenetic differences in a gene that is a biomarker for cancer?

Answer 39

Real-time PCR using primers that are complimentary to methylated or unmethylated DNA sequences.

Question 40

What are two common polymerizing agents used when casting a polyacryamide gel?

Answer 40

TEMED and APS