ASCP MB Exam Flashcards
What assay amplifies the target using a combination of a three-enzyme system?
Nucleic acid sequence based amplification (NASBA)
In real-time PCR, what is amplified?
The target
Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence?
58C
Splicing
is not a source of DNA damage
Which type of RNA molecule is responsible for transporting amino acids during protein synthesis?
tRNA
Given the anti-sense strand of DNA: 5’-AATTGCCGACATAGAT-3’ what is the sense strand?
5’-ATCTATGTCGGCAATT-3
What adjustment is unlikely to increase the specificity of a PCR reaction?
Decreasing the annealing temp of primers
Components of nucleic acids
phosphate group
sugar (ribose or deoxyribose)
nitrogenous base
What characteristic of the genetic code facilitates ID of open reading frames in DNA sequences
Out-of-frame or chance consecutive codons tend to be short, often ending in a stop codon
On a size-exclusion column, large molecules will elute ____ small molecules
Before
MALDI methods separate ions by
mass and charge regardless of volume
What is a heteroduplex
One double-stranded DNA molecule w/one or more non-complementary bases
What method IDs the presence of a mutation but not the mutant sequence
SSCP
What is the function of DNA in the cell?
To act as a storage system for genetic information
How do purines and pyrimidines differ?
Purines have a double ring, pyrimidines have a single ring
Which of the ribose carbons participate in the phosphodiester bond?
The 5’ C connects to a hydroxyl group on the 3’ ribose C of the previous nucleotide.