ASCP MB Exam Flashcards
What assay amplifies the target using a combination of a three-enzyme system?
Nucleic acid sequence based amplification (NASBA)
In real-time PCR, what is amplified?
The target
Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence?
58C
Splicing
is not a source of DNA damage
Which type of RNA molecule is responsible for transporting amino acids during protein synthesis?
tRNA
Given the anti-sense strand of DNA: 5’-AATTGCCGACATAGAT-3’ what is the sense strand?
5’-ATCTATGTCGGCAATT-3
What adjustment is unlikely to increase the specificity of a PCR reaction?
Decreasing the annealing temp of primers
Components of nucleic acids
phosphate group
sugar (ribose or deoxyribose)
nitrogenous base
What characteristic of the genetic code facilitates ID of open reading frames in DNA sequences
Out-of-frame or chance consecutive codons tend to be short, often ending in a stop codon
On a size-exclusion column, large molecules will elute ____ small molecules
Before
MALDI methods separate ions by
mass and charge regardless of volume
What is a heteroduplex
One double-stranded DNA molecule w/one or more non-complementary bases
What method IDs the presence of a mutation but not the mutant sequence
SSCP
What is the function of DNA in the cell?
To act as a storage system for genetic information
How do purines and pyrimidines differ?
Purines have a double ring, pyrimidines have a single ring
Which of the ribose carbons participate in the phosphodiester bond?
The 5’ C connects to a hydroxyl group on the 3’ ribose C of the previous nucleotide.
Which of the ribose carbons carries the nitrogen base?
The 1’ C
Why does the DNA polymerase require primase activity?
A 3’ hydroxyl group from an existing nucleotide must be present to form the phosphodiester bond.
How does DNA move from cell to cell via conjugation?
DNA is shared by direct cell-to-cell contact
How does DNA move from cell to cell via transduction?
Viral or bacteriophage vectors carry DNA from cell to cell.
How does DNA move from cell to cell via transformation?
Fragmented or plasmid DNA enters cells from the surrounding environment
After meiosis, games produced from diploid organisms are _____.
Haploid
List the three processing steps undergone by messenger RNA
mRNA is capped during transcription and polyadenylated as part of termination. The transcript is further processed by splicing
What is the function of polyadenylate polymerase?
It adds adenosine nucleoties to the 3’ end of mRNA
The parts of the hnRNA that are translated into protein are the ______.
exons
The intervening sequences that interrupt protein-coding sequences in hnRNA are _____.
introns
A procedure for DNA digestion w/a restriction enzyme includes a final incubation set of 5 min at 95C. What is the likely purpose of this final step?
This step will inactivate the protein, preventing its activity in subsequent steps in the assay.
What is a ribozyme?
RNA molecule that can metabolize other molecules like an enzyme
What is the nonprotein prosthetic group for glycoprotein?
sugars
What is the nonprotein prosthetic group for lipoprotein?
lipids
What is the nonprotein prosthetic group for metalloprotein?
metal atoms
Exosomes
Small vesicles that form by invagination and budding from the inside of cellular endosome vesicles and are secreted by living cells. They contain proteins, lipids, and nucleic acids and can be collected by centrifugation.
Automated DNA isolation systems use cartridges containing what
lysis, adsorption, and elution agents, and magnetic beads
Chelex
cation-chelating resin that can be used for simple extraction of DNA from minimal samples
Most abundant type of RNA
rRNA (80-90%)
RNA on a gel
High-quality total RNA appears as two rRNA bands reprsenting large (28S) and small (18S) ribosomal RNA species
Beer-Lambert law
Used to determine concentration from the absorptivity constants (
What describes the two types of bacteriophages
Virulent or temperate
Which technique can be used to detect epigenetic differences in a gene that is a biomarker for cancer?
Real-time PCR using primers that are complimentary to methylated or unmethylated DNA sequences.
What are two common polymerizing agents used when casting a polyacryamide gel?
TEMED and APS
