20 +11

Question 1

What is the polymerase chain reaction (PCR)?

Answer 1

It amplifies a gene by copying it over and over again.

Question 2

What are the three basic steps in PCR?

Answer 2

Denaturation, Annealing, extension

Question 3

What is DNA sequencing?

Answer 3

Figuring out the order of the nucleotides in a gene.

Question 4

How are restriction enzymes like transcription factors? How are they different?

Answer 4

They are like transcription factors because they are used to regulate cell processes. They are different because the transcription factors are located on the DNA strands and the restriction enzymes aren’t attached.

Question 5

How could reverse transcriptase be used to produce clones of genes without introns?

Answer 5

Reverse transcriptase transcribes the DNA backwards so that the cDNA can find its complementary intron.

Question 6

Why would a researcher want clones of genes without introns?

Answer 6

This would be beneficial if they want to study only the sequences that are leaving the cell.

Question 7

What does reverse transcriptase do?

Answer 7

It transcribed DNA into mRNA backwards.

Question 8

How could reverse transcriptase be used to reveal which genes in a cell’s genome were expressed at a given time?

Answer 8

It could be used with cDNA to remove the introns. Only the exons would be left and these are the sequences that are expressed.

Question 9

How can in vitro mutagenesis be used to study the function of a gene in an organism? How does this create a “knock out” organism?

Answer 9

It can be used by introducing a mutation into a cloned gene and then inserting that gene into a cell. It disables the other copies of that gene in the cell.

Question 10

How can RNA interference be used to study the function of a gene in an organism?

Answer 10

Synthetic RNA can be used to mimic the processes in which the cell uses interfering RNA to degrade mRNA or stop translation.

Question 11

What is a SNP?

Answer 11

An SNP is called single nucleotide polymorphism. It is when 1% of the population has a base pair variation at one site.

Question 12

Describe three applications of PCR.

Answer 12

forensic analysis
ecological study
copy genes for genetic engineering
evolution study

Question 13

Describe three applications of DNA sequencing.

Answer 13

understanding genetics-phenotype
medical (disease origin/risk, understanding cell physiology, personalized medicine)
understanding development
evolutionary relationships

Question 14

What is meant by “cloning a gene”?

Answer 14

Cloning a gene makes a copy of a specific gene.

Question 15

What is the utility of cloning a human gene into a plasmid?

Answer 15

Plasmids replicate independently, so this would allow the gene to clone faster.

Question 16

What is meant by “cloning an organism”?

Answer 16

Cloning an organism inserts its DNA into an embryo so that it will have the same phenotype and genotype as
the cloned organism.

Question 17

What is the utility of coning an organism?

Answer 17

The purpose is to create genetically identical organisms.

Question 18

What sort of organisms produce restriction enzymes and what is their function?

Answer 18

Bacteria and archaea produce restriction enzymes and they cut DNA at specific points on the sequence.

Question 19

How are restriction enzymes used when conducting gene splicing?

Answer 19

They can cut out unwanted sequences from the DNA so that only certain parts are used for the experiment.

Question 20

How are restriction enzymes selected to create “sticky ends” when a gene is moved from its normal chromosome, into the chromosome of another organism?

Answer 20

Sticky ends are the single stranded ends created by restriction enzymes. They can bond with the complementary sticky end of a strand in another chromosome.

Question 21

Even though the SNP shown in figure 20.14 is not part of the gene being studied, how does checking for it. Does a person still tend to indicate if that individual is carrying the normal or diseased gene?

Answer 21

If the person has the SNP, then they are unlikely to have the disease gene.

Question 22

What are pluripotent stem cells and why are they special?

Answer 22

They are able to develop into many different cell types

Question 23

What is unique about totipotent stem cells?

Answer 23

The cells can generate a complete new organism

Question 24

How does the ability to convert adult pluripotent stem cells into totipotent stem cells avoid controversy?

Answer 24

avoid taking cells from the embryo

Question 25

What is controversial about human gene therapy?

Answer 25

Unnatural, unknown side effects, against some people’s beliefs

Question 26

How is “CRISPR” better for cutting DNA than restriction enzymes like EcoR1?

Answer 26

It can be more specific than restriction enzymes

Question 27

Why are gap junctions and plasmodesmata needed for cell to cell communication if cells are adjacent to one another?

Answer 27

They both provide a pathway through the cell membrane.

Question 28

How is synaptic signaling more precise than signaling through gap junctions/plasmodesmata?

Answer 28

Synaptic signaling uses neurotransmitters to act as a chemical signal. This allows only the target cell to accept the signal. Cap junctions and plasmodesmata are only holes in which cellular contents can pass. Unwanted materials might also pass through when this method is used

Question 29

How is paracrine signaling different from endocrine signaling?

Answer 29

Paracrine signaling is an example of local signaling and endocrine signaling is long-distance signaling.

Question 30

Why do G protein coupled receptors need to have both hydrophobic and hydrophilic regions?

Answer 30

This is because they are integral proteins that reside in the cytoplasm but need a hydrophobic region so that they can attach to the cell membrane.

Question 31

How can a receptor protein function if it is located inside a cell (vs in the plasma membrane)?

Answer 31

It floats around until a hormone attaches to it. It then enters the nucleus to active/deactivate certain genes.

Question 32

How can the transduction of a signal through a cell in many steps lead to the signal becoming much stronger (amplified)?

Answer 32

This is because more enzymes each time.

Question 33

How is it that a hormone distributed through the bloodstream to the whole body alters the activity of certain cells, but has no effect on other cells?

Answer 33

Not all cells have the receptor for that hormone.

Question 34

How is it that a hormone distributed through the bloodstream can have opposite effects on different cell types? (Ex. epinephrine increases the activity of skeletal muscle but decreases the activity of smooth muscle).

Answer 34

The receptor protein may be complementary to different genes so that different responses can occur.

Question 35

Towards which charge does DNA migrate during electrophoresis?

Answer 35

It migrates towards the positive charge.

Question 36

Which part of each nucleotide is electrically charged?

Answer 36

The phosphate groups are negatively charged.

Question 37

What variables determine how far a band moves in the gel?

Answer 37

The size of the DNA fragments and how much charge it has.

Question 38

How can a segment of interest be detected on a pcr gel with many bands? (CATCATCATCATCATCATCATCATCATCAT)

Answer 38

If the DNA probe contains the complementary sequence (GTAGTAGTAGTAGTAGTAGTAGTAGTAGTA) it will attach to the DNA.

Question 39

If you put one drop of saliva into a DNA loading well, you would not have enough DNA to get identifiable bands. How could you get enough DNA from a drop of saliva in order to detect sequences of interest in DNA?

Answer 39

You could perform PCR on the DNA to amplify it.