2. Human + oral microbiome Flashcards
LOs
I. Describe the types of micro-organisms found in the human body and
give examples of each
II. Describe the bacterial communities found normally in the gut, on the
skin and in the mouth
III. Describe the basic applications and principles of bacterial genome
sequencing techniques
IV. Appreciate how microbiology research has developed to utilise the
available genome sequence data
V. Be aware of the potential, and the limitations, of genome sequence-led
research to identify novel antimicrobial strategies (therapeutics and
vaccines) and other biotechnology products
what is taxonomy
- branch of science concerned with classification especially oragnisms
~ life
~ domain
~ kindom
~ phylum
~ class
~ order
~ family
~ genus
~ species
EGs of prokaryotes + eukaryotes
EUKARYOTE
- animalia
- Plantae
- Protista
- fungi
PROKARYOTE
- bacteria
- archae
KEY TERMS TO LEARN
1. Habitat
2. Microbial community
3. Microbiota
4. Microbiome
5. Metagenome
6. Biofilm
- Habitat = specific site of organism growth
- Microbial community =The micro-organisms that are present in a given habitat
- Microbiota = The total collection of micro-organism within a microbial community
- Microbiome = The microbiota and all of its associated genes
- Metagenome = Total genomic DNA of all the organisms within a comm
- Biofilm = A physically (often temp) structures aggregate of microorganisms, adhered to each other and/or a defined substrate (i.e dental plaque attached to a tooth / gum margin)
The Human Microbiome
10X
- There are 10X more microbial cells in the human body than human cells
> 10,000
- The number of different species
identified to-date within the human
body
22,000
- The number of genes in the human
genome
> 3.3 million
- The number of genes in the human gut
microbiome
The Human Microbiome – why is it important?
MICROBIAL GENES
- Modulate fundamental human physiological
processes
- Examples: Metabolism, Energy acquisition,
Immune modulation, Neurological development
HEALTH
- Specific microorganisms are protective
against disease, and pathogenic bacterial
species
DISEASE
- Changes in the composition of the microbiome are associated with disease
-Examples: Inflammatory Bowel Disease, Obesity,
Diabetes, Rheumatoid Arthritis
Human microbiome project (HMP)
1. why research
2. What research
- Launched in 2008 till 2013
- Funded $115 million to International consortium
- Aims of HMP:
- Generate resources to help study the human microbiome
- Characterize the microbiome associated with human health and
disease - Determine whether individuals share a core human microbiome
- To understand whether changes in the human microbiome result
in changes to human health
Five Fundamental Questions Underlying HMP
- What microbes populate the human host?
- What are these microbes doing?
- How does the host respond to these microbes?
- What are the forces that maintain equilibrium among the microbial
communities? - What are the unique characteristics of each individuals microbiome?
How do you study the Microbiome?
-What do we use to do?
-New approach
- How they work?
- The Traditional Culture Approach
* Grow microbes directly from sample
* Requires phenotypic identification of isolates
* Morphology / Motility
* Biochemical
* Antibody / Serological
* Metabolic - The New Molecular Approach
* Identifies organisms by gene sequence homology
* Extract microbial DNA from samples
* Sequence analysis of DNA
* Targeted sequencing (16s rRNA)
* Shotgun Metagenomics sequencing
- Traditional Cultivation Approach
positives + negatives
POSITIVE
* Cheap
Negative
* Labour intensive [> 24 hours for org ID]
* Only gross species discrimination possible
* Not many species can grow (only 50% of
known oral bacteria are currently cultivable
in the laboratory)
* Need to know what species to expect
- New Molecular Approaches
positives + negatives
Positives
* Tells you what is present not just what you can grow
* Can tell you what genes are present
* Higher discriminatory power for species
identification
Negatives
* Sequence bias due to primer specificity
* Expensive
* Time consuming and Computational taxing
Targeting the Bacterial 16S rRNA Gene
- 1542 bp gene
- Found in all bacteria and archaea
- Encodes the small subunit of the
ribosomal complex, necessary for
protein synthesis - “molecular clock”
- rDNA sequence similarities correlated
with ‘evolutionary relatedness’ - Little evidence of horizontal gene
transfer - highly variable regions allow for
discrimination of bacterial genera
HOW TO MAKE SENSE OF SEQUENCING DATA?
- Sequence output is a list of A, T, G, C’s
‘ATGCATCGATCGTACTGACTATGCATATAGTTCA’ - Comparison of A, T, G, C’s to curated databases
for identification - 16S rRNA database for taxonomic identification
(2011 green genes database contains
1,049,116 aligned 16S rDNA records >1250nt) - Genome databases for metagenomics (ie.
Database of all know genes of interest) - Limitations
- Can only identify sequences present in our databases
- Need to perform whole genome sequencing of more organisms so this genetic information
can be added to the databases - Need to annotate the sequences. Ie. What do the ATCG’s code for? What is their function?
WHICH GENES ARE WE INTERESTED IN? (What do they do?)
- Are genes that contribute to the pathogenicity of the organism
(ie. endotoxin genes, fimbriae genes, genes that encode cell wall proteins)
Resistance genes: - Genes that induce antibiotic resistance (ie. Erm genes, mecA gene)
Diagnostic markers: - Genes that aid in the rapid diagnosis of disease (ie. Hepatitis antibodies for HepC) Genes for
biotechnology applications: - Novel production processes
Microbiome findings so far
- Colonisation begins at birth
- Microbiome changes over time
~Most dramatically in the first 3 years of life - Influenced by diet, lifestyle, environment.
-Microbiomes are characteristic if each body site
~ Body sites create different environmental habits for bacterial growth
- The individual is the primary determinant for composition - everyone’s microbiome is different
- Microbiome plays a role in disease - e.g obesity, type 2 obesity
The Oral Microbiome
- High numbers of bacteria in the mouth
- ~108
/ml in saliva - ~109
/mg in plaque - Highly diverse
- more than 700 species
- Comprised of several different microbial habitats:
- Teeth, saliva, supragingival and subgingival plaque, tongue,
buccal mucosa, hard and soft palates, tonsils - Saliva commonly used as a representative for the oral
microbiome - Associated with oral diseases in most individuals
- Therefore this microbiota is not in full harmony with
the host.
Oral Microbiota changes over time
- Not just a simple build up of microbes.
- There is a shift in the species seen as plaque develops.
- Microbiome-host interactions play a key role in this process
Dynamic Changes in Plaque Microbiota and Disease
Process of periodontal disease
Exploitation of genome sequences
